Fungal endophytes have been shown to improve abiotic and biotic stress response in plants. Grasses growing along the Oregon coast are exposed to harsh conditions and may harbor endophytes that enable them to survive and grow under these conditions. Endophytic fungi were isolated from thirty-four grass plants representing eight different grass species at four different locations along the Oregon coast. The ITS-1, 5.8S, and ITS-2 regions of each isolate were amplified, sequenced, and used to perform a BLAST search against the nucleotide database collection at National Center for Biotechnology Information. One-hundred-eleven different fungal isolates were classified into thirtynine genera with two isolates that did not show a match greater than 95%. These endophytes will be investigated to determine their potential for improving the adaptability of grasses and other crop plants to grow in diverse environments where they are subjected to multiple biotic and abiotic stresses.
It is estimated that the human population will reach nine billion by 2050. This population increase combined with climate change will require an increase in food production under less than optimal conditions. In the mid- late 20th century, the “Green Revolution” was the result of breeding efforts aimed at improved crop cultivars, the introduction of hybrids, and increased agricultural inputs in terms of fertilizer, pesticides, water, herbicides and crop management practices. We are now facing a similar global food security challenge that will require continued improvements in crop yields and agricultural production practices. Climate change and the expansion of agricultural production to marginal lands will also require innovative ways to increase abiotic and biotic stress tolerance and improve nutrient uptake efficiency in crop plants to meet future global food demands.
Many plants contain endophytic organisms that Wilson (1995) defined as “fungi or bacteria which, for all or part of their life cycle, invade the tissues of living plants and cause unapparent and asymptomatic infections entirely within plant tissues but cause no symptoms of disease” [
Although less well studied, another group of endophytes that also have been shown to provide enhanced abiotic and biotic stress tolerance to their hosts, is the nonclavicipitaceous fungal endophytes of the subkingdom Dikarya [
Another endophytic fungus currently being explored for agricultural potential, Piriformospora indica, was first isolated from xerophytes growing in a desert in India [
Many of the endophytes described above have been identified in plants that are exposed to abiotic and biotic stresses. Grasses growing along the Oregon coast are exposed to salinity stress as well as other abiotic and biotic stresses. In order to survive in this demanding environment, these grasses may contain a unique population of fungal endophytes. The long-term goal of this study is to isolate fungal endophytes associated with these grasses that have the potential to enhance plant growth/biomass and/or impart abiotic and biotic stress tolerance to forage, turf, and energy-related grasses and/or other plant species. This paper describes the initial isolation and identification of fungal endophytes from various grasses growing in sandy soils and exposed to ocean spray and mist along the Oregon coast.
Samples (root crown, leaves, and stems) were collected from grasses growing in areas exposed to ocean spray, mists and tides along the Oregon coast. Grasses were collected from sites near Harbor Vista (Lat/Long 44.021629 - 124.133127), Coos Bay (Lat/Long 43.366501 - 124.217888), Bob Creek Wayside (Lat/Long 44.244493 - 124.111582), and Yachats (Lat/Long 44.3105 - 124.103976) (
Samples were stored in plastic bags in a cooler with ice during collection and refrigerated until processing for endophyte isolation. All samples were processed within 48 h of collection. Samples were rinsed with water to remove soil and debris, swirled in a beaker containing distilled water and two drops of Tween 20/100 ml, and rinsed again prior to cutting the tissue. Any dead plant tissue and most of the roots were removed from the plant, and the remaining plant was dissected into tissues corresponding to the root crown (1 - 1.5 cm), leaves (4 - 6 cm in length), and stems (4 - 6 cm in length) prior to surface sterilization. After plant tissues were visibly clean, the tissues were rinsed in tap deionized water and then placed between damp paper towels to prevent them from drying out until tissues were sterilized prior to plating for fungal isolation. Stems and root crowns were surface sterilized by placing the tissue in 90% ethanol for 1 min, 3% sodium hypochlorite (from bleach) with 2 drops of Tween-20/100 ml for 3 min, sterile double distilled water (DDW) for 1 min, 70% ethanol for 1 min, and a quick
Location | Plant ID | Species | Location | Plant ID | Species |
---|---|---|---|---|---|
Coos Bay | CB2 | Bromus | Bob Creek Wayside | BS1 | Lolium |
CB3 | Ammophilia | BS2 | Bromus | ||
CB4 | Festuca | BS3 | Bromus | ||
CB5 | Hordeum | BS4 | Phalaris | ||
Harbor Vista | HV1 | Phalaris | BS5 | Festuca | |
HV2 | Phalaris | BS6 | Bromus | ||
HV3 | Festuca | BS7 | Festuca | ||
HV4 | Festuca | BS8 | Festuca | ||
HV5 | Bromus | BS9 | Phalaris | ||
HV6 | Festuca | ||||
HV7 | Ammophila | Yachats | YH1 | Phalaris | |
HV8 | Bromus | YH2 | Bromus | ||
HV9 | Festuca | YH3 | Bromus | ||
HV10 | Agrostis | YH4 | Descampsia | ||
HV11 | Bromus | YH5 | Agrostis | ||
HV12 | Bromus | YH6 | Phalaris | ||
HV13 | Festuca | YH7 | Agrostis | ||
HV14 | Festuca |
rinse in sterile DDW. Leaf tissue was sterilized by placing leaves in 70% ethanol for 2 min, 2% sodium hypochlorite (from bleach) for 3 min, sterile DDW for 1 min, followed by a quick dip in 90% ethanol. After sterilization, the end (~2 - 3 mm) of stem, leaf or root crown was cut off and discarded. The remaining sample was cut into 2 - 3 mm sections and divided between two plates containing either Bacto™ Potato Dextrose Agar (PDA) or BBL™ Corn Meal Agar with added Malt (1 g/L) and Yeast Extract (2 g/L) (CMMY) (Becton, Dickinson & Co; Sparks, MD) containing 50 mg/L of carbenicillin and streptomycin. Plates were incubated at room temperature and examined for emerging fungi every 2 - 3 days. As fungi emerged, they were transferred to PDA plates to obtain pure cultures. Prior to initial plating, several samples were imprinted onto media and these imprinted plates were monitored for lack of fungal growth to ensure the effectiveness of the sterilization technique [
DNA was extracted from pure cultures following the simple miniprep method of Saitoh et al. [
The rDNA ITS region was amplified by PCR with primers ITS5 (GGAAGTAAAAGTCGTAACAAGG) and ITS4 (TCCTCCGCTTATTGATATGC) [
A representative sample from each clade of the phylogenetic tree from the Megablast search results was tested for antibiotic production. Fungi were grown on plates without any antibiotics for 7 - 14 days. Bacteria (Frigoribacterium [Frig] and Bacillus, also collected from coastal grasses) were grown overnight in LB media, diluted 1:20 in LB, and then spread as a lawn on LB/PDA agar plates (500 mls; 2.5 g peptone, 1.25 g yeast extract, 2.5 g NaCl, 3.75 g agar, pH 6.5). A cork borer was used to remove 3 plugs (~7 mm in diameter) from each plate. A comparable sized plug of the fungus to be tested for antibiotic activity was placed into two of the bacterial plate holes and a negative media plug (no fungus) was placed in the third hole. Bacteria were allowed to grow for 24 - 48 h and then the plate was examined for the presence of zones of bacterial growth inhibition next to the fungal plug.
Thirty-four different plant samples were collected from various sites along the Oregon coast; four from Coos Bay, 14 from Harbor Vista, nine from Bob Creek Wayside, and seven from Yachats (
The distribution of the fungal isolates at different locations is listed in
The distribution of fungal isolates in the different grass species is presented in
Fungal endophytes are known to produce many secondary metabolites, some with antimicrobial activity (reviewed in [
Bob Creek Wayside | Coos Bay | Harbor Vista | Yachats | |
---|---|---|---|---|
Alternaria sp. | 2 | 1 | 2 | |
Articulospora | 1 | |||
Ascomycota sp. | 2 | 5 | 3 | 3 |
Aureobasidium sp. | 1 | 1 | ||
Beauveria sp. | 1 | |||
Cf. Acremonium sp. | 1 | |||
Chaetomium sp. | 1 | |||
Chaunopycnis sp. | 1 | |||
Cladosporium sp. | 1 | 1 | 6 | |
Diaporthe sp. | 2 | |||
Drechslera | 2 | |||
Embellisia sp. | 1 | |||
Epichloe | 1 | |||
Exophiala sp. | 1 | |||
Fusarium sp. | 1 | 1 | 2 | 1 |
Helgardia | 2 | |||
Helotiales | 1 | |||
Heterobasidion sp. | 1 | |||
Homobasidiomycete | 1 | |||
Hypocreales | 2 | |||
Isaria | 1 | |||
Microdochium sp. | 1 | 2 | 1 | |
Mucorales sp. | 1 | |||
Neotyphodium sp. | 1 | |||
Oidiodendron sp. | 1 | 1 | ||
Paraphaeosphaeria sp. | 1 | 1 | ||
Penicillium sp. | 1 | 1 | 2 | |
Phaeosphaeria sp. | 2 | 5 | 2 | |
Phlebia sp. | 1 | |||
Phoma sp. | 1 | 2 | ||
Pleospora sp. | 1 | |||
Pleosporales sp. | 1 | |||
Pseudoseptoria sp. | 1 | 3 | 1 | |
Saccharicola sp. | 1 | |||
Sarocladium sp. | 2 | 1 | 1 | |
Septoriella sp. | 1 | 2 | ||
Stemphylium sp. | 5 | 3 | ||
Trichoderma sp. | 1 | |||
Umbelopsis sp. | 1 | |||
Isolates with <95% ID | 2 | |||
# diff. fungi genera/site | 22 | 22 | 34 | 29 |
# plants collected/site | 9.0 | 4.0 | 14 | 7 |
# fungi/plant/site | 2.4 | 5.5 | 2.4 | 4.1 |
Overall: Avg number of fungi/plant 3.14 |
Fungi ↓ Grass*→ | Br | Am | Fe | Ho | Ph | Ag | Lo | De | Total | Order |
---|---|---|---|---|---|---|---|---|---|---|
Alternaria sp. | 3 | 1 | 1 | 5 | Pleosporales | |||||
Articulospora | 1 | 1 | Helotiales | |||||||
Ascomycota sp. | 7 | 2 | 1 | 3 | 13 | |||||
Aureobasidium sp. | 2 | 2 | Dothideales | |||||||
Beauveria sp. | 1 | 1 | Hypocreales | |||||||
Cf. Acremonium sp. | 1 | 1 | Hypocreales | |||||||
Chaetomium sp. | 1 | 1 | Sordariales | |||||||
Chaunopycnis sp. | 1 | 1 | Hypocreales | |||||||
Cladosporium sp. | 1 | 1 | 1 | 1 | 2 | 2 | 8 | Capnodiales | ||
Diaporthe sp. | 1 | 1 | 2 | Diaporthales | ||||||
Drechslera | 1 | 1 | 2 | Pleosporales | ||||||
Embellisia sp. | 1 | 1 | Pleosporales | |||||||
Epichloe | 1 | 1 | Hypocreales | |||||||
Exophiala sp. | 1 | 1 | Chaetothyriales | |||||||
Fusarium sp. | 1 | 1 | 2 | 1 | 5 | Hypocreales | ||||
Helgardia | 2 | 2 | Helotiales | |||||||
Helotiales | 1 | 1 | Helotiales | |||||||
Heterobasidion sp. | 1 | 1 | Russulales | |||||||
Homobasidiomycete | 1 | 1 | ||||||||
Hypocreales | 2 | 2 | Hypocreales | |||||||
Isaria sp. | 1 | 1 | Hypocreales | |||||||
Microdochium sp. | 1 | 1 | 2 | 4 | Xylariales | |||||
Mucorales sp. | 1 | 1 | Mucorales | |||||||
Neotyphodium sp. | 1 | 1 | Hypocreales | |||||||
Oidiodendron sp. | 1 | 1 | 2 | |||||||
Paraphaeosphaeria sp. | 1 | 1 | 2 | Pleosporales | ||||||
Penicillium sp. | 2 | 1 | 1 | 4 | Eurotiales | |||||
Phaeosphaeria sp. | 1 | 1 | 3 | 1 | 2 | 1 | 8 | Pleosporales | ||
Phlebia sp. | 1 | 1 | Polyporales | |||||||
Phoma sp. | 1 | 1 | 1 | 3 | Pleosporales | |||||
Plectosphaerella sp. | 1 | 1 | ||||||||
Pleospora sp. | 1 | 1 | Pleosporales | |||||||
Pleosporales sp. | 1 | 1 | Pleosporales | |||||||
Pseudoseptoria sp. | 1 | 3 | 1 | 5 | Dothideales | |||||
Saccharicola sp. | 1 | 1 | Pleosporales | |||||||
Sarocladium sp. | 1 | 1 | 2 | 4 | Hypocreales | |||||
Septoriella sp. | 3 | 3 | Hypocreales | |||||||
Stemphylium sp. | 2 | 2 | 2 | 1 | 1 | 8 | Pleosporales | |||
Trichoderma sp. | 1 | 1 | Hypocreales | |||||||
Umbelopsis sp. | 1 | 1 | Mucorales | |||||||
Isolates with <95% ID | 1 | 1 | 2 | |||||||
SUMMARY | Br | Am | Fe | Ho | Ph | Ag | Lo | De | Total | |
# of fungi/species | 31 | 9 | 30 | 4 | 14 | 7 | 1 | 9 | 107 | |
# of plants | 10 | 2 | 10 | 1 | 6 | 3 | 1 | 1 | 34 | |
AVG # of fungi/ Ind. sp. | 3.1 | 4.5 | 3 | 4 | 2.3 | 2.3 | 1 | 9 | 3.15 |
*Abbreviations: Br (Bromus), Am (Amophilia), Fe (Festuca), Ho (Hordeum), Ph (Phalaris), Ag (Agrostis), Lo (Lolium), De (Descampsia).
Isolate | Species | Accesion # | % Coverage | % ID |
---|---|---|---|---|
CB4RCSSD | Alternaria infectoria | HG324079.1 | 100 | 100 |
HV8SSA | Alternaria infectoria str CNRMA10.1102 | KP131537.1 | 99 | 100 |
HV8SSB | Alternaria infectoria str CNRMA10.143 | KP131538.1 | 99 | 100 |
BS9SSA | Alternaria infectoria str CNRMA10.143 | KP131538.1 | 99 | 100 |
BS2SSA | Alternaria sp. GYI-051221 | FJ627005.1 | 99 | 100 |
BS7RCB | Articulospora proliferata str CCM F-11200 | KP234351.1 | 100 | 97 |
CB3AL2 | Ascomycete sp. DGC-2 | AY230245.1 | 100 | 98 |
BS2RCB | Ascomycota sp. UNEX FECRGA 2012E081 | KP698333.1 | 100 | 100 |
BS3LA | Ascomycota sp. UNEX FECRGA 2012E081 | KP698333.1 | 100 | 100 |
HV8SSC | Ascomycota sp. UNEX FECRGA 2012E081 | KP698333.1 | 100 | 99 |
CB4RCSSB | Ascomycota sp. UNEX FECRGA 2012E081 | KP698333.1 | 100 | 100 |
YH4SSD | Ascomycota sp. UNEX FECRGA 2012E143 | KP899390.1 | 100 | 99 |
HV11LA,RCF | Ascomycota sp. UNEX FECRGA 2012E217 | KP899440.1 | 100 | 100 |
HV12RCA,SS | Ascomycota sp. UNEX FECRGA 2012E217 | KP899440.1 | 100 | 100 |
CB3BRCB | Ascomycota sp. UNEX FECRGA 2012E497 | KP899421.1 | 100 | 99 |
YH4RCC1 | Ascomycota sp. UNEX FECRGA 2012E547 | KP899402.1 | 100 | 99 |
CB2A-LD | Ascomycota sp. UNEX FECRGA 2012E651 | KP698369.1 | 100 | 99 |
YH4RCB | Ascomycota sp. UNEX FECRGA 2012E651 | KP698369.1 | 100 | 99 |
CB2ALC | Ascomycota sp. UNEX FECRGA 2012E497 | KP899421.1 | 100 | 99 |
CB2ARCB | Aureobasidium pullulans isolate 24-3 | KP783506.1 | 100 | 100 |
YH2RCD | Aureobasidium sp. 3 BRO-2013 | KF367567.1 | 100 | 99 |
CB3ARCC | Beauveria bassiana str WM 09.202 | KP131647.1 | 99 | 99 |
HV14RCE | Cf. Acremonium sp. SS-1583 | AM262388.1 | 79 | 97 |
YH6SSC | Chaetomium sp. CGMCC 3.9441 | JN209925.1 | 100 | 99 |
CB5-SSB | Chaunopycnis sp. ANT 03-065 | DQ402530.2 | 100 | 100 |
YH4RCA | Cladosporium cladosporioides | AB975285.1 | 100 | 100 |
YH6RCB | Cladosporium ramotenellum | LN834387.1 | 100 | 100 |
YH7LA | Cladosporium ramotenellum | LN834387.1 | 100 | 99 |
YH2LA | Cladosporium sp. 4 SDM-2014 | LN834427.1 | 100 | 100 |
YH4SSA | Cladosporium sp. 4 SDM-2014 | LN834427.1 | 100 | 100 |
CB5SSA | Cladosporium sp. 5 SDM-2014 | LN834419.1 | 100 | 100 |
YH7LC | Cladosporium sp. 5 SDM-2014 | LN834419.1 | 100 | 100 |
BS7LA | Cladosporium sp. 5 SDM-2014 | LN834419.1 | 100 | 100 |
HV5LA | Diaporthe cf. nobilis RG-2013 | KC343153.1 | 100 | 99 |
---|---|---|---|---|
HV3LA | Diaporthe eres strain UCCE1004B | KF017914.1 | 100 | 100 |
CB2BLC | Drechslera dematioidea str CBS 108962 | JN712465.1 | 100 | 99 |
CB3BRCC | Drechslera dematioidea str CBS 108962 | JN712465.1 | 100 | 99 |
CB5RCB | Embellisia sp. 9151S6 | JQ796753.1 | 100 | 99 |
BS5LB,RCD | Epichloe festucae | X62987.1 | 100 | 99 |
HV9SSB | Exophiala pisciphila isolate AFTOL-ID 669 | DQ826739.1 | 100 | 100 |
HV4RCA | Fusarium acuminatum str RJFAWY137YT2E | KR051403.1 | 100 | 100 |
YH4SSC | Fusarium avenaceum | AB975293.1 | 100 | 100 |
BS8LE | Fusarium avenaceum | AB975293.1 | 100 | 100 |
CB2ARCC | Fusarium culmorum isolate MF18 | KP292806.1 | 100 | 100 |
HV7RCA | Fusarium pseudograminearum str NRRL28062 | DQ459871.1 | 100 | 99 |
HV14SSD | Helgardia aestiva isolate RAE22 | AY266145.1 | 97 | 98 |
HV13LB | Helgardia aestiva isolate RAE22 | AY266145.1 | 100 | 99 |
YH4RC3 | Helotiales sp. CWG-F1-E3 | JF690986.1 | 97 | 99 |
HV11RC | Heterobasidion occidentale isolate PFC 5364 | KC492948.1 | 100 | 100 |
BS2L1c | Homobasidiomycete sp. WRCF-B9 | AY618675.1 | 96 | 99 |
YH6SSE | Hypocreales D_D31 | KC311472.1 | 98 | 98 |
YH6SSFR | Hypocreales sp. IBL 03161 | DQ682584.1 | 98 | 99 |
BS2LA | Isaria sp. 07MA19 | JX270419.1 | 100 | 100 |
CB2BLA, RCB | Microdochium bolleyi | AM502264.1 | 100 | 100 |
CB5SSFung | Microdochium bolleyi | AM502264.1 | 100 | 100 |
YH1RCD | Microdochium nivale | AM502260.1 | 100 | 100 |
BS9RCA | Microdochium phragmitis | AM502263.1 | 100 | 99 |
HV9RCB | Mucorales sp. DU13 | KM113751.1 | 100 | 99 |
HV13RC | Neotyphodium coenophialum str CBS 494.82 | DQ119115.1 | 100 | 100 |
CB3ARCA | Oidiodendron sp. 06VT08 | JX270395.1 | 100 | 98 |
BS3SS3 | Oidiodendron sp. 06VT08 | JX270395.1 | 100 | 99 |
YH1RCB | Paraphaeosphaeria neglecta str CBS 627.94 | JX496101.1 | 100 | 100 |
YH5RCA | Penicillium janthinellum str GYJ1(1) | KM268660.1 | 100 | 100 |
CB2ALA, RCA | Penicillium murcianum str CBS 161.81 | KP016844.1 | 100 | 100 |
YH6RCE | Penicillium sp. IFB-E022 | EF211128.1 | 97 | 97 |
HV11RCD | Penicillium nothofagi CBS 130383 | NR_121518.1 | 100 | 100 |
HV14SSA | Phaeosphaeria avenaria str QLF50 | FJ623271.1 | 100 | 97 |
CB3ARCA | Phaeosphaeria pontiformis | AJ496632.1 | 100 | 99 |
HV10SSA | Phaeosphaeria sp. I147 | GU062238.1 | 69 | 97 |
YH4RCC2 | Phaeosphaeria sp. I147 | GU062238.1 | 67 | 97 |
HV1RCA | Phaeosphaeria sp. I147 | GU062238.1 | 67 | 97 |
---|---|---|---|---|
HV11RCC | Phaeosphaeria sp. JP-2013 str WA0000019138 | JX981472.1 | 100 | 99 |
CB4RCSSA | Phaeosphaeria sp. S-93-48 | EF452730.1 | 99 | 99 |
HV6RCB | Phaeosphaeria sp. S-93-48 | EF452730.1 | 99 | 99 |
YH5RCB | Phaeosphaeria vagans str CBS 604.86 | KF251193.1 | 99 | 99 |
BS3L1 | Phlebia uda strain FP-101544-Sp | KP135361.1 | 100 | 99 |
YH3RCB | Phoma sp. | KF646102.1 | 100 | 99 |
YH4RC4 | Phoma sp. | KF646102.1 | 100 | 99 |
HV2RCB | Phoma sp. | KF646102.1 | 100 | 99 |
HV9RCA | Plectosphaerella cucumerina str WM 07.196 | KP068972.1 | 99 | 100 |
HV2LA | Pleospora sp. 286A | GQ120976.1 | 100 | 99 |
YH2RCA | Pleosporales sp. ICMP 17119 | HM116749.1 | 100 | 100 |
BS8SSB | Pseudoseptoria obscura str CBS 135103 | KF251219.1 | 97 | 99 |
HV11SSB | Pseudoseptoria obscura str CBS 135103 | KF251219.1 | 89 | 99 |
HV9SSA | Pseudoseptoria obscura str CBS 135103 | KF251219.1 | 97 | 99 |
YH4SSB | Pseudoseptoria obscura str CBS 135103 | KF251219.1 | 97 | 99 |
HV14LA | Pseudoseptoria obscura str CBS 135103 | KF251219.1 | 97 | 99 |
HV5LB | Saccharicola bicolor isolate wb557 | AF455415.1 | 99 | 99 |
YH6SSB | Sarocladium strictum | AB975290.1 | 100 | 99 |
BS4SSA | Sarocladium strictum | AB975290.1 | 100 | 99 |
BS7SSB | Sarocladium strictum | AB975290.1 | 100 | 100 |
CB3BLA | Sarocladium strictum | AB975290.1 | 100 | 100 |
BS8LA | Septoriella phragmitis str CPC 24118 | KR873251.1 | 99 | 99 |
HV13LA | Septoriella phragmitis str CPC 24118 | KR873251.1 | 99 | 99 |
HV14LB | Septoriella phragmitis str CPC 24118 | KR873251.1 | 99 | 99 |
YH1LD | Stemphylium solani str SS21 | AF203448.1 | 100 | 99 |
BS1LA | Stemphylium solani str SS21 | AF203448.1 | 100 | 99 |
BS3LB | Stemphylium solani str SS21 | AF203448.1 | 100 | 99 |
BS5LA | Stemphylium solani str SS21 | AF203448.1 | 100 | 99 |
BS7LB | Stemphylium solani str SS21 | AF203448.1 | 100 | 99 |
YH7LB | Stemphylium solani str SS21 | AF203448.1 | 100 | 99 |
BS2LB | Stemphylium vesicarium isolate CCTU237 | JX424812.1 | 100 | 100 |
YH1LA | Stemphylium vesicarium isolate CCTU237 | JX424812.1 | 100 | 99 |
CB3BRCD | Trichoderma viridescens str TRS35 | KP009338.1 | 100 | 100 |
HV9RC1 | Umbelopsis ramanniana str NRRL 5844 | KM017730.1 | 99 | 99 |
HV10SSB | Unknown | |||
HV6RCA | Unknown |
Phaeosphaeria sp. (from Harbor Vista plant 14) and Aureobasidium sp. (from Yachats plant 2). Penicillium species were initially included in the study as a potential positive control for the assay, because it is the source of the common antibiotic penicillin, and was expected to be positive.
Another isolate obtained from Festuca at Harbor Vista was also able to inhibit growth of Frig and Bacillus and based on the ITS sequence, this isolate was most closely related to a species of Phaeosphaeria. Interestingly, antibacterial activity of phaeosphenone, a compound isolated from Phaeosphaeria, has been previously reported [
Fungi can form different types of associations with plants, some beneficial and some harmful. Parasitic, saprophytic and pathogenic fungi can be very deleterious to a plant, while endophytes and mycorrhizal fungi are considered beneficial symbionts which promote plant growth, confer enhanced resistance to various pathogens and pests, and improve survival under unfavorable environmental conditions [
Several other studies have described the isolation of endophytes from plants growing in salt stressed or harsh environments. As mentioned earlier, Fusarium culmorum, isolated from dunegrass growing in coastal habitats, has been shown to be necessary for salt tolerance of this plant [
Schultz et al. [
Grasses provide forage and ecological benefits that contribute significantly to our agricultural, environmental, economic, and social well-being. Grasses are a valuable forage species, but are also becoming more important as buffers for watersheds, habitat for biologically diverse plants and animals, and as sinks for carbon sequestration. Adaptable, high-yield, low-input grass varieties and management strategies are needed to enhance the utility of these grasslands and to meet the goals of improved food and energy security. The Willamette Valley of Oregon produces over 50% of the world’s cool season grass seed. The presence of fungal endophytes in grasses has been shown to improve the persistence and productivity of grasses when challenged with abiotic and biotic stresses, but information about the potential for isolating and adapting new endophytes from other grasses to improve rangeland, pasture, turf and bioenergy grasses is limited. The purpose of this study is to identify novel fungal endophytes that are native to Oregon that will allow us to improve grass stress tolerance without using direct genetic modification and without introducing foreign or exotic species into this diverse agricultural production area. The discovery of novel endophytes has the potential to improve yield and persistence, as well as increase the adaptability of these grasses to multiple stresses encountered in end-use environments.
Special thanks is extended to Thomas Lockwood, Stephanie Samard, and Lori Evans-Marks (USDA-ARS FSCRU, Corvallis Oregon) for their assistance in processing plant and fungal samples, and Richard Halse at Oregon State University for his help in identification of grasses. Experimental methods performed in this research complied with current laws and regulations of the USA. Mention of trademark, vendor, or corporation names in this publication is for the information and convenience of the reader. Such use does not constitute an official endorsement or approval by the United States Department of Agriculture or the Agricultural Research Service of any product or service to the exclusion of others that may be suitable.
Ruth C. Martin,James E. Dombrowski, (2015) Isolation and Identification of Fungal Endophytes from Grasses along the Oregon Coast. American Journal of Plant Sciences,06,3216-3230. doi: 10.4236/ajps.2015.619313