Chitinolytic activities were measured in two fish species having different feeding habits, chub mackerel ( Scomber japonicus ) and silver croaker ( Pennahia argentata ). Chitinase (an endo-type chitinolytic enzyme) activity was measured using pNP-(GlcNAc) n (n = 2, 3) as substrates; its level was significantly high in the stomachs of both species, as well as in the gills, intestine, pyloric appendage, testis, and liver of chub mackerel and in the spleen, kidney, pyloric appendage, ovaries, heart, and liver of silver croaker. β - N -Acetylhexosaminidase (an exo-type chitinolytic enzyme) activity was measured using pNP-(GlcNAc) as a substrate; it was detected at high levels in many parts apart from the digestive tracts of both species. The optimum pH for chitinase activity was 3.0 - 5.0 in the stomachs of both species, 4.0 in the liver of chub mackerel, and 4.0 and 8.0 in the kidney of silver croaker. Full-length cDNAs encoding two chitinase isozymes were obtained from the stomachs of the two fish species: SjChi- 1 (1604 bp) and SjChi- 2 (1512 bp) from chub mackerel and PaChi- 1 (1630 bp) and PaChi- 2 (1606 bp) from silver croaker. Expression analysis of these genes in the organs of the two species revealed strong expression of SjChi- 1 in the stomach of chub mackerel and that of PaChi- 1 and PaChi- 2 in the stomach of silver croaker. The difference in the expression pattern of these genes is likely attributed to the difference in the feeding habits of the two fish species. Our results suggested the presence of novel chitinases in the two species.
Chitin is an amino polysaccharide containing N-acetyl-d-glucosamine (GlcNAc) units connected with β-1,4 linkages. It is a renewable biological resource that is abundantly present worldwide and is found in the exoskeletons of arthropods, cell walls of fungi, and the epidermis of nematodes [
Chitinolytic enzymes degrade chitin and are classified according to the degradation mechanisms as endo-type chitinolytic enzyme, which produce (GlcNAc)n by randomly degrading chitin internally, and exo-type chitinolytic enzyme, which produce GlcNAc by degrading chitin sequentially from the nonreducing ends [
Although the majority of studies on chitinase have been conducted on microorganisms [
Our laboratory has been investigating the purification, characteristics, and cDNA cloning of chitinases by using various samples, including fish (osteichthyes [
In this study, we determined the distribution of chitinase and Hex activities in chub mackerel, which lives in the ocean surface and feeds on chitin from zooplankton [
Chub mackerel (mean body length: 40 cm) and silver croaker (mean body length: 25 cm) were freshly obtained on the day they were caught (June and August, respectively), and chitinolytic activity was measured and cDNA cloning were performed on the same day.
The organs to be analyzed were removed from the chub mackerel and silver croaker. Next, 0.5 g of each organ was homogenized in three volumes of 20 mM phosphate buffer (pH 7.3), and then the homogenate was centrifuged at 9000 × g for 20 min. The supernatant was used as the crude enzyme solution. Chitinase and Hex activities were measured using p-nitrophenyl (GlcNAc)n, (pNP-(GlcNAc)n) (n = 2, 3) (Seikagaku, Tokyo, Japan) and pNP-GlcNAc (Seikagaku), respectively, as substrates according to the method described by Ohtakara [
The optimum pH was measured for the crude enzyme solutions obtained from the stomach and liver of chub mackerel and the stomach and kidney of silver croaker by using 0.2 M phosphate-0.1 M citrate buffer (pH = 2 - 8) and the mixture of 0.1 M glycine and 0.1 M NaCl-0.1 M NaOH (pH = 9), respectively, by using the same technique as was used for the measurement of chitinolytic activity.
Total RNA was extracted from the stomachs of the chub mackerel and silver croaker by using ISOGEN (Nippon Gene, Tokyo, Japan) according to the manufacturer’s instructions. The extracted total RNA was treated with RQ1 RNase-Free DNase (Promega, Madison, WI) according to the manufacturer’s instructions. Next, cDNA was synthesized using 1.0 μg of total RNA; a reverse transcriptase M-MLV (Takara Bio, Shiga, Japan); and an oligo dT primer (
Primer name | Sequence (5'-3') | Length | Usage | |
---|---|---|---|---|
Oligo dT | CTGTGAATGCTGCGACTACGATTTTTTTTTTTTTTTTTTT | 40mer | cDNA synthesis | |
Chi-a (F) | TGYTAYTTYACNAAYTGG | 19mer | Conserved region PCR | |
Chi-b (F) | GAYATHGAYTGGGARTAYCC | 19mer | ||
Chi-c (R) | TTCCARTARTTCATNGCRTARTC | 19mer | ||
3’RACE (R) | CTGTGAATGCGACTACGAT | 19mer | 3'RACE PCR | |
AAP (F) | GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG | 36mer | 5'RACE PCR | |
AUAP (F) | GGCCACGCGTCGACTAGTACC | 21mer | ||
β-actin 1 (F) | AGCCAACAGAGGAGGCTCTTA | 21mer | Tissue expression PCR | |
β-actin 2 (R) | GATTCCTAAGAGTGAATG | 18mer | ||
Chub mackerel | SjChi1-1(F) | ACCAACATTGACCCATGTCTCTGTG | 25mer | 3'RACE PCR |
SjChi1-2(F) | ATGGACAACAACATGATCAAGAC | 23mer | ||
SjChi2-1(F) | GGTGAGTGCAGTCCCCTGTTCA | 22mer | ||
SjChi1-3(R) | CTCCAATGGCCAACAGAGTCTTCA | 24mer | 5'RACE PCR | |
SjChi1-4(R) | TGGAACTGTCCGTAGAGTTTTTC | 23mer | ||
SjChi1-5(R) | GTTGTTGTCCATTGATGCAAAGG | 23mer | ||
SjChi1-6(R) | GGTCAATGTTGGTGGGTAGGTACT | 24mer | ||
SjChi2-2(R) | AAGACGAATAGTCTAAGGGTT | 21mer | ||
SjChi2-3(R) | GAATCAATGGTGTCCTTTCCA | 21mer | ||
SjChi2-4(R) | ACAGCAGCAGACATCAGAAGACG | 24mer | ||
SjChi1-7(F) | TACAGAAGCAATATGGGCAAACTACTC | 27mer | Full length amplification | |
SjChi1-8(R) | AGTGGAATGGTCTTGTGTTTCATGATA | 27mer | ||
SjChi2-5(F) | CGGTAGCCATGGGGAAAGTACTG | 23mer | ||
SjChi2-6(R) | ACAACAGTTATCCAGTCAATTTAT | 24mer | ||
SjChi1-9(F) | CATCCACGTCATGTCCTACGA | 21mer | Tissue expression PCR | |
SjChi1-10(R) | CGTTGTTGTAGGCATATGGCA | 21mer | ||
SjChi2-8(F) | GTCATATGACTTCCATGGCTC | 21mer | ||
SjChi2-9(R) | CCCACTGATTTCCCTTGTAAG | 21mer | ||
Silver croaker | PaChi1-1(F) | GGACTACTTCCACGTCATG | 19mer | 3’RACE PCR |
PaChi2-1(F) | TGTGGACTACGCCATGAACTAC | 19mer | ||
PaChi1-2(R) | CCACATTGAAGTAGATCAT | 19mer | 5’RACE PCR | |
PaChi1-3(R) | CATGACGTGGAAGTAGTCC | 19mer | ||
PaChi1-4(R) | GCGAGGACGGTTGGTCTTCT | 20mer | ||
PaChi2-3(R) | GTAGTTCATGGCGTAGTCCACA | 22mer | ||
PaChi2-4(R) | GAAATAGATGAAGCCACCC | 19mer | ||
PaChi2-5(R) | GGCCGAGCTTGGGGATCTGAT | 21mer | ||
PaChi1-5(F) | TACAGAAGCACCATGGGCAAGCTAC | 25mer | Full length amplification | |
PaChi1-6(R) | GCTTTAAATGCGACGTTTATTTAA | 24mer | ||
PaChi2-6(F) | TACACGGTAGCCATGGGGAAA | 21mer | ||
PaChi2-7(R) | GCTTTCAAATCAACCACTCAAGACG | 25mer | ||
PaChi1-7(F) | GAGCACAATGTCGGAGAGAAC | 21mer | Tissue expression PCR | |
PaChi1-8(R) | ACCACTCTGCTTCAGCCACTG | 21mer | ||
PaChi2-8(F) | GACCCCATGACTGGTGAGTGC | 21mer | ||
PaChi2-9(R) | GTTACTCTTAGTCAGCCAGTC | 21mer |
Total RNA was extracted from the organs of chub mackerel and silver croaker. cDNA was synthesized using 0.5 μg of total RNA obtained from each tissue and an oligo dT primer and amplified using PCR by using 1.0 μg of the synthesized cDNA; primers for SjChi-1, SjChi-2, PaChi-1, and PaChi-2; and fish β-actin amplification primers (
Phylogenetic tree analysis, based on the deduced amino acid sequences of the full-length genes of SjChi-1, SjChi-2, PaChi-1, and PaChi-2, was performed using the chitinase genes obtained from many organisms. The analysis was performed using ClustalW2 (EMBL-EBI) and Tree view programs.
Chitinolytic activity showed the highest levels of chitinase activity against pNP-(GlcNAc)2 and pNP-(GlcNAc)3 in the stomachs of chub mackerel and silver croaker. Chitinase activity was also detected in the gills, intestine, pyloric appendage, testes, and liver of chub mackerel (
The effect of pH on chitinase activities was determined in the stomach and liver of chub mackerel and the stomach and kidney of silver croaker in order to compare the optimum pH for chitinase activity in the digestive tract and the other organs. Maximum activity was observed at pH of 3.0 against pNP-(GlcNAc)2 and at pH 5.0 against pNP-(GlcNAc)3 in the stomach of chub mackerel, whereas, at pH 7.0, the activity against the two substrates remained less than 35% of the maximum activity. In contrast, the optimum pH was found to be 4.0 against both substrates in the liver of chub mackerel, and approximately 70% of the maximum activity was retained even at pH 7.0. More than 80% of the maximum activity was observed at pH 3.0 to 6.0 against the two substrates in the stomach of silver croaker, whereas the activity reduced to less than 15% of the maximum activity at pH 8.0. Maximum activity was observed at pH 4.0 and 8.0 against both substrates in the kidney (
The acidic optimum pH for chitinase activity observed in the stomachs of the two species, liver of chub mackerel, and kidney of silver croaker was similar to that observed for chitinase isozymes purified from the stomachs of marbled rockfish [
silver croaker was similar to that of 7.0 and 9.0 for chitinase activity in the serum of Nile tilapia [
Two genes of approximately 350 bp were obtained after amplification of the internal sequence of chitinase genes obtained from the stomachs of chub mackerel and silver croaker. Sequence analysis by NCBI Blast revealed high degrees of homology with threeline grunt stomach chitinase genes (PtChi-1 and PtChi-2) [
Phylogenetic tree analysis was performed based on sequence homology among the amino acid sequences of SjChi-1, SjChi-2, PaChi-2, and PaChi-2 as well as those of chitinases from other biological species, where SjChi-1 and SjChi-2 as well as PaChi-1 and PaChi-2 were found to be classified into AFCase-1 and AFCase-2, respectively, that include fish stomach chitinases (
The expression of SjChi-1, SjChi-2, PaChi-1, and PaChi-2 was examined in the organs of chub mackerel and silver croaker. SjChi-1 was strongly expressed in the stomach of chub mackerel, whereas the expression of SjChi-2 was insignificant. This suggests that chub mackerel, which lives in the ocean surface, mainly uses SjChi-1 for the degradation of α-chitin, which is a structural component of zooplankton exoskeletons. In addition, the expression of SjChi-1 was observed in the pyloric appendage, in which chitinase activity was detected, suggesting that SjChi-1 is an enzyme involved in the digestion of chitin in the pyloric appendage. In contrast, both PaChi-1 and PaChi-2chitinases were found to be strongly expressed in the stomach of silver croaker (
In the present study, chitinase activity was observed in the organ where the expression of chitinase genes of the two fish species was not detected, suggesting the presence of novel chitinases that are distinct from those encoded by chitinases belonging to AFCase-1 and AFCase-2. This finding, together with the results shown in
flounders [
The distribution patterns of chitinolytic enzymes in chub mackerel and silver croaker revealed, to our knowledge, for the first time that chitinase activities are broadly distributed in the organs of the two species, in addition to the digestive tract, including the stomach. Measurement of optimum pH for chitinase activity in chub mackerel and silver croaker revealed the presence of a chitinase that shows maximum activity at pH 4.0 and 70% of the maximum activity at pH 7.0 in the liver of chub mackerel, and a chitinase that shows maximum activity at pH 4.0 and 8.0 in the kidney of silver croaker. This suggests the presence of novel chitinases in the two fish species that act at around neutral pH, in addition to enzymes that are analogous to the previously reported fish stomach chitinases that have the optimum pH in the range of 3.0 to 5.0. Full-length cDNAs encoding the two chitinase genes for each species, SjChi1 and SjChi2, as well as PaChi1 and PaChi2, were obtained from the stomachs of the two species; these genes belong to AFCase-1 and AFCase-2, respectively. Expression analysis of these chitinase genes in the organs of the two fish species showed significant differences in the expression pattern in the stomachs, which was likely attributed to the difference in the feeding habits between the two species. In addition, the expression of these genes was observed only in some of the organs in which chitinase activity was detected, suggesting the presence of novel chitinases that are distinct from those encoded by genes belonging to AFCase-1 and AFCase-2.
This work was supported in a part by a Grant-in-Aid for Scientific Research (C) (no. 25450309).
HiromiKakizaki,ManaIkeda,HidetoFukushima,MasahiroMatsumiya, (2015) Distribution of Chitinolytic Enzymes in the Organs and cDNA Cloning of Chitinase Isozymes from the Stomach of Two Species of Fish, Chub Mackerel (Scomber japonicus) and Silver Croaker (Pennahia argentata). Open Journal of Marine Science,05,398-411. doi: 10.4236/ojms.2015.54032