Chayote [ <i>Sechium edule </i> (Jacq.) Sw.] is an economically important species in Latin America; however, there are very few reports available regarding its genetic diversity. Out of 11 microsatellite markers isolated, 10 loci provided 1 to 7 alleles per locus in a set of Mexican chayote accessions. Observed and expected heterozygosities for each locus ranged from 0.00 to 0.85 and 0.00 to 0.73, respectively. The overall genetic diversity detected by microsatellites was compared with that detected by P450-based analogue markers, a genome-wide dominant marker. Genetic diversity values obtained by the newly designed microsatellite markers were almost equal to the value estimated by PBA markers, but genetic distances calculated by both marker systems were not significantly correlated. Additional microsatellite markers, which could detect more polymorphisms, may be necessary to analyze the genetic diversity and structure of Mexican chayote collections.
Chayote [Sechium edule (Jacq.) Sw.] is an economically important species of Cucurbitaceae in Latin America; however, very few reports are available regarding its genetic diversity. Commercial production for local consumption and export of the fresh fruit is a significant source of revenue and local employment in Mexico [
Historical records and linguistics, occurrence of wild forms, and the distribution of related wild species indicate that the geographical origin is in tropical America, especially in Mexico and Central America [
Although morphological variation has been reported [
In this paper, first we report the design of 11 species-specific microsatellite markers using Japanese chayote varieties. Second, the designed markers were evaluated by using 20 Mexican chayote accessions. Finally, results of genetic diversity analysis with the newly designed microsatellite markers were compared with those detected by P450-based analogues (PBAs) markers [
Total genomic DNA was extracted from dried leaves of the Japanese local variety of chayote, “Zairai Wase”, by CTAB method [
Flanked regions of the microsatellite were isolated from these four DNA libraries by amplification using com- pound microsatellite primers (AC)10 or (GA)10 and the adaptor primer AP2 (5’-CTATAGGGCACGCGTGGT-3’) designed from the 48-mer adapter. The amplified fragments were then integrated into a plasmid pGEM-T vector using pGEM-T Easy Kit (Promega); the plasmids were then transferred into Escherichia coli DH5α, according to the manufacturer’s instructions. The cloned fragments were amplified from the extracted plasmid DNA of positive clones using M13 forward and M13 reverse primers. The size of inserted fragments were checked by 1% agarose gel electrophoresis and the PCR products were directly sequenced with the M13(-21) primer using BigDye Terminator v3.1 Cycle Sequencing Kit (Life Technology) in the ABI 3130 Genetic Analyzer (Life Technology). Each fragment containing (AC)n or (GA)n sequence at one end was chosen for the next step.
The next step consisted of determining the sequence of the other flanking regions for each microsatellite. A pair of primers, IP1 and IP2, was designed from each sequence. IP1 was a nested specific primer, designed from the flanking region of the microsatellites, whereas IP2 was designed based on the sequence between IP1 and the microsatellite. All these primers were designed using Primer3Plus [
Amplification of the newly designed markers was tested on 20 Mexican chayote accessions comprising 10 varietal groups with different fruit morphological characteristics (Supplementary
General genetic diversity values were calculated at each locus. Pair-wise genetic distances among 20 individuals were calculated using “Codom-Genotypic” option to enable comparisons between codominant (microsatellites) and dominant (PBA) data output. Principal coordinate analysis (PCoA) was also carried out. All these analyses were carried out using GenAlEx 6.5 [
Locus | Primer sequence 5' > 3' | Repeat motif | Genbank no. | Sizea (bp) | N | Na | Ho | He | PIC | |
---|---|---|---|---|---|---|---|---|---|---|
Sed 01 | F: | CCCCGTTACCCTGACTCTCGAT | (CA)8 | AB871395 | 196 | 20 | 2 | 0.85 | 0.50 | 0.37 |
R: | GGCTTGTTCAAGACTTCGCAGC | |||||||||
Sed 02 | F: | AGAAGACGACACACTTTTGAGCA | (CA)2C (CA)5 | AB871396 | 316 | 20 | 1 | 0.00 | 0.00 | 0.00 |
R: | ATCTACCCGTGACTGCCCAGAT | |||||||||
Sed 03 | F: | CGTATGGTCGAGGTGCGCATAA | (CA)9 | AB871397 | 144 | 20 | 5 | 0.15 | 0.51 | 0.48 |
R: | AAGTCCAGAAATGTACACTGCCACT | |||||||||
Sed 04 | F: | GGCCCTTAGTTTGCTGATGGGT | (CA)2CT(CA)2CC(CA)3 | AB871398 | 378 | 20 | 1 | 0.00 | 0.00 | 0.00 |
R: | TGGGACCCACGTGCTAAAAGTG | |||||||||
Sed 05 | F: | ACACACCTTAGAAAGAGCAACCCC | (CA)2CGA(CA)5 | AB871399 | 274 | 20 | 1 | 0.00 | 0.00 | 0.00 |
R: | GCTATGGCGCAAGTTGCTGATG | |||||||||
Sed 06 | F: | AACCGCTGTTCTCTGCTCATCC | (CA)4TA(CA)16 | AB871400 | 229 | 20 | 3 | 0.15 | 0.14 | 0.14 |
R: | GGCTCAAGGTTGTTGTTGGTGC | |||||||||
Sed 07 | F: | AACCTGGGTCGTTACATGGTGC | (GA)34 | AB871401 | 359 | 20 | 3 | 0.15 | 0.22 | 0.21 |
R: | ACCCTTGCCCTAGATGGTGGAA | |||||||||
Sed 08 | F: | AGCTCCTCCACCTCTACCTTTTGC | (GA)3GC(GA)5 | AB871402 | 382 | 20 | 3 | 0.15 | 0.14 | 0.14 |
R: | ACTCTGGCGTATGGAATGACGC | |||||||||
Sed 09 | F: | ACAGGCCACAGGGGAACAAAAT | (GA)11 | AB871403 | 204 | 20 | 5 | 0.20 | 0.57 | 0.51 |
R: | CACGCCATCTCCGTCCATCTTT | |||||||||
Sed 11 | F: | TGGTCTGTTTGGCTCATCTCCA | (GA)14 | AB871405 | 299 | 20 | 7 | 0.11 | 0.73 | 0.68 |
R: | TCGACCCCTAACCCTTGAAGCT | |||||||||
Mean | 20 | 3.1 | 0.21 | 0.28 | 0.25 |
aPCR product with Japanese variety “Zairai wase”. Note: N = sample size; Na = Number of effective alleles; Ho = observed heterozygosity; He = expected heterozygosity; PIC = polymorphism information content.
Genetic diversity values from the same set of Mexican chayote samples were evaluated using PBA markers [
For statistical analysis, amplified DNA fragments were scored in a binary data matrix, where the presence of band was denoted as 1 and its absence as 0. A single data matrix was prepared by combining genotyping results of 8 primer combinations and general genetic diversity values were calculated. Genetic distances among individuals were calculated and PCoA was also carried out. The correlation between estimates of genetic distances based on PBA and microsatellite data was determined by Mantel test [
A total of 40 clones from the (AC)10 and 24 clones from the (GA)10 libraries were randomly chosen based on amplification size (≥500 bp) and were sequenced. Eighteen (45%) and 9 (37.5%) clones, respectively, from each library, had enough sequence length to design two primers between repeat motif and adapter sequences, and they were used to design IP1 and IP2 primers. In total, 15 primer pairs were designed, 7 from the (AC)10 library and 8 from the (GA)10 library. These primers were initially tested on a subset of S. edule individuals from the Japanese varieties to confirm reliable amplification. Of these, 4 amplified multiple loci while 11 were polymorphic and produced a single band (GenBank accession no.: AB871395 to AB871405).
Specie-specificity of the newly designed markers was confirmed by cross amplification with arbitrary selected other plant species. Four genotypes of heliconias (Heliconia bourgaeana, H. bihai, H. collinsiana and H. uxpanapensis) and four chayote genotypes were tested with primers designed in this study. Amplifications were observed only from chayote DNA samples, and not from heliconias. Equally, cross-amplification of microsatellite markers designed for heliconias (Hac-A116 and Hac-D1) [
Primer pairs/combinations | Annealing temp. (˚C) | Number of polymorphic bands |
---|---|---|
CYP1A1F/CYP1A1R | 56 | 15 |
CYP1A1F/CYP2B6R | 52 | 11 |
CYP1A1F/CYP2C19R | 47 | 9 |
CYP2B6F/CYP1A1R | 52 | 5 |
CYP2B6F/CYP2C19R | 47 | 14 |
CYP2B6F/CYP2B6R | 52 | 15 |
CYP2C19F/CYP1A1R | 56 | 17 |
CYP2C19F/CYP2C19R | 47 | 2 |
Average | - | 11 |
The 11 polymorphic primer pairs were further tested on 20 individuals from a Mexican collection (BANGESe, National Sechium edule Germplasm Bank, Huatusco, Veracruz, Mexico). One primer combination (Sed10) was discarded from further analysis because it produced too much stutter bands and size determination was not possible. Out of 10 loci tested, 7 microsatellites showed polymorphism, ranging from 1 to 7 alleles per locus (
Among 20 Mexican chayote individuals tested, only one pair (SE-369 and SE-288) demonstrated identical patterns of allelic combinations, both of them belonged to the same varietal group, albus levis, and share identical fruit characteristics. However, individuals that belonged to other varietal groups (e.g., albus minor, SE-261 and SE-330) exhibited different genotyping patterns. There is still a need for development of additional markers to increase resolution so that microsatellite markers can be used for genotype identification and, in some cases, for marker-assisted selection. However, these results suggest that the DNA profiles based on the application of newly designed microsatellite markers could be used to differentiate chayote individuals and accessions.
Chayote is known as a predominantly cross-pollinated species but its low heterozygosity is reported by isozyme studies [
Although the set of Mexican chayote collection consisted of a broad range of varietal group with high diversity in fruit morphology (Supplementary
From the 9 primer combinations evaluated for the PBA markers, 8 showed polymorphisms on the same set of Mexican chayote samples. The total number of polymorphic bands was 88, ranging from 2 (CYP2C19F/CYP2C19R) to 17 (CYP2C19F/CYP1A1R) (
Microsatellite markers are widely used for fingerprinting and diversity studies of different species. In this study, we reported the design of 11 microsatellite markers for chayote. Ten of them were easily genotyped and 7 of them detected polymorphisms in a set of Mexican chayote accessions. When compared with the results obtained by 8 combinations of PBA markers, the genetic diversity indicators calculated by these microsatellites were almost equivalent but demonstrated different grouping patterns. However, the designed markers sets were not efficient enough to discriminate clearly different genotypes. It may be necessary to develop more microsatellite markers in order to detect more polymorphisms, more precise genotyping, and larger scale genetic diversity germplasm collections. Currently, development of additional microsatellite markers is under process and these markers will be useful to characterize population genetic structures of chayote varieties of Mexico and Latin America and to decipher the dynamics of its genetic diversity.
This research was supported by JST/JICA, SATREPS (Science and Technology Research Partnership for Sustainable Development) “Diversity Assessment and Development of Sustainable Use of Mexican Genetic Resources: a SATREPS Project”, Japan, INIFAP and Interdisciplinary Research Group Sechium edule in Mexico (GiSeM).
RyokoMachida-Hirano,MoisésCortés-Cruz,Blanca AmaliaAmaro González,Jorge CadenaÍñiguez,KazutoShirata,Kazuo N.Watanabe, (2015) Isolation and Characterization of Novel Microsatellite Markers in Chayote [Sechium edule (Jacq.) Sw.]. American Journal of Plant Sciences,06,2033-2041. doi: 10.4236/ajps.2015.613203