Arbuscular mycorrhiza (AM) is one of the most spread symbiosis established between 80% of land plants and soil fungi belonging to the Glomeromycota. Molecular determinants involved in the formation of arbuscular mycorrhizas are still poorly understood. It has been demonstrated that in both Legumes and rice plants, several GRAS transcription factors are directly involved in both mycorrhizal signaling and colonization, namely NSP1, NSP2, RAM1, DELLA, DELLA-interacting protein (DIP1) and RAD1. Here, we focused on a rice GRAS protein, named <i>Arbuscular Mycorrhizal </i> 18 ( <i>OsAM18 </i>), previously identified as specifically expressed in rice mycorrhizal roots, and considered as an AM-specific gene. Phylogenetic analysis revealed that OsAM18 had a peculiar amino acid sequence, which clustered with putative SCARECROW proteins, even though it formed a separate branch. Allelic <i>osma18 </i> mutant displayed a drastic reduction in mycorrhizal colonization in-tensity and in arbuscule abundance, as mirrored by <i>OsPT11 </i> expression level. Non-mycorrhizal <i>osam18 </i> plants displayed a comparable plant development and root apparatus compared with the WT, while mycorrhizal <i>osam18 </i> mutants showed a reduction of plant biomass compared with mycorrhizal WT plants. The results suggest that OsAM18 is a rice protein, which is likely to have an impact not only on the colonization process and AM functionality, but also on the systemic effects of the AM symbiosis.
The arbuscular mycorrhizal (AM) symbiosis is established between fungi of the Glomeromycota phylum and more than 80% of land plant species, being therefore the most widespread terrestrial symbiosis [
GRAS proteins belong to a huge family which has been divided in several subfamilies. The name derives from three family members, GAI (GIBBERELLIC ACID INSENSITIVE), RGA (REPRESSOR of GAI) and SCR (SCARECROW) [
Here we focused our study on the biological function of a rice GRAS protein, named Arbuscular Mycorrhizal 18 (OsAM18), previously identified as exclusively induced in mycorrhizal roots during transcriptomic analysis [
Rice (cv Nipponbare) line carrying Tos17 insertion into osam18 coding sequence (line NC5532) was selected from public databases (http://signal.salk.edu/cgi-bin/RiceGE) and provided by the Rice Genome Resource Center of the National Institute of Agrobiological Sciences (RGRC-NIAS), Japan. To isolate homozygous mutants, DNA extraction [
Seedlings of Oryza sativa ssp. japonica cv. Nipponbare wild-type and of osam18 mutant line were inoculated with Funelliformis mosseae Gerd. & Trappe BEG12 (MycAgro Lab, France, www.mycagrolab.com) by mixing the inoculum with sterile quartz sand (30% v⁄v) [
Fresh weight of root and shoot tissues of the control (c) and mycorrhizal (myc), mutant and wild-type, rice plants was evaluated. Each tissue was isolated and the fresh weight was measured by means of analytical balance.
OsAM18 nucleotide sequence was obtained from the Rice genome Annotation Project (http://rice.plantbiology.msu.edu/), corresponding to the annotated “GRAS family transcription factor containing protein, expressed” (LOC_Os03g40080). The position of exons and introns was predicted using a program available at http://www.ncbi.nlm.nih.gov/IEB/Research/Ostell/Spidey/spideyweb.cgi.
The GRAS domain was identified by ScanProsite and NCBI Blastp tools [
All the rice sequences containing a GRAS domain were retrieved from the Rice Genome Annotation Project website (http://rice.plantbiology.msu.edu/index.shtml) [
On the basis of the HMM (Hidden Markov Model) logo of the GRAS family (PF03514) available at Pfam website (http://pfam.xfam.org/family/PF03514#tabview=tab4), a custom Perl script was developed to find and isolate the most conserved part of the GRAS domain from each of the selected proteins. Only domains matching the following signature pattern H-[I,V]-[I,V]-D(84,260)-W(44,98)-W-x(10)-W were used for the alignment and the subsequent phylogenetic analysis. Alignment was done by ClustalX v. 2.1 [
In order to describe the root system architecture, the length of Crown Roots (CRs) and the number of Large Lateral Roots (LLRs) were annotated manually for each plant. The branching index (BI = n LLR/cm CR) was calculated as described by Vallino and colleagues (2014) [
Portions of mycorrhizal roots were stained with cotton blue and the level of mycorrhizal formation was assessed according to Trouvelot and colleagues (1986) [
To assess the arbuscule phenotype, WT and osam18 mutant roots were treated for 1 h in phosphate buffer, pH 7, containing 3% (w/v) paraformaldehyde. After washing in phosphate buffer, roots were embedded in 8% low melting agarose and sectioned with a series 1000 Microtome Sectioning System (Vibratome, St. Louis, MO, USA). Two hundred µm thick-vibratome sections were treated for 5 min in 0.5% commercial bleach, diluted in phosphate buffer, washed again, and then incubated for 2 h with wheat germ agglutinin-fluorescein isothiocyanate (WGA-TRITC) (Sigma-Aldrich, Milan, Italy), at a final concentration of 10 μg/mL, to detect fungal cell walls. Working conditions for the Leica TCS SP2 confocal microscope (Leica Microsystems GmbH, Wetzlar, Germany) and for observations and image acquisition were used as described by Volpe and colleagues (2013) [
To examine the presence of aerenchyma, 25 different portions of the sampled LLRs were embedded and sectioned as described above. Cross sections, 100 µm thick, were observed under a light microscope [Primo Star Zeiss (Carl Zeiss MicroImaging, Göttingen, Germany) with a Leica DFC425 digital camera (Leica Microsystems, Wetzlar, Germany) attached].
Genomic DNA was extracted from F. mosseae sporocarps. Approximately 50 sporocarps were added to 50 µl of 10X Red Taq (Sigma) buffer and crushed with a sterile pestle. The sample was heated at 95˚C for 15 min and centrifuged at 12,000 g for 5 min. The supernatant was transferred to a new tube and stored at −20˚C. Fungal genomic DNA was used to test each primer pair used for real-time PCR to exclude cross hybridization.
Total RNA was extracted from rice roots of mycorrhizal and non-mycorrhizal plant grown via the sandwich method using the Plant RNeasy Kit (Qiagen), according to the manufacturer’s instructions. Samples were treated with TURBO™ DNase (Ambion, Austin, TX, USA) according to the manufacturer’s instructions. The RNA samples were routinely checked for DNA contamination by means of RT-PCR (OneStepRT-PCR, Qiagen) analysis, using OsRubQ1 [
For single-strand cDNA synthesis, about 700 ng of total RNA was denatured at 65˚C for 5 min and then reverse-transcribed at 25˚C for 10 min, 42˚C for 50 min and 70˚C for 15 min. The final volume was 20 µl and contained 10 µM random primers, 0.5 mM dNTPs, 4 µl 5× buffer, 2 µl 0.1 M DTT, and 1 µl Super-Script II (Invitrogen, Carlsbad, CA, USA).
Quantitative RT-PCR (qRT-PCR) was performed using an iCycler apparatus (Bio-Rad, Hercules, CA, USA). Each PCR reaction was carried out in a total volume of 20 µl containing 1 µl diluted cDNA (about 20 ng), 10 µl 2X SYBR Green Reaction Mix and 3 µl of each primer (3 µM).The following PCR program was used: 95˚C for 90 s, 50 cycles of 95˚C for 15 s, 60˚C for 30 s. A melting curve (80 steps with a heating rate of 0.5˚C per 10 s and a continuous fluorescence measurement) was recorded at the end of each run to exclude the generation of non-specific PCR products [
Baseline range and Ct values were automatically calculated using iCycler software. Transcript levels were normalized to the Ct value of OsRubQ1 (OsRubQ1f: GGGTTCACAAGTCTGCCTATTTG; OsRubQ1r: ACGGGACACGACCAAGGA) [
GRAS proteins belong to a family of transcriptional regulators unique to plants. They play important regulatory roles in a number of plant processes including signaling, development, abiotic stress, and symbiosis [
Here, we focused on a rice GRAS protein previously identified by a whole transcriptome analysis as being specifically expressed in rice mycorrhizal roots and silent in response to mock treatment [
The OsAM18 cDNA sequence is 2334 nt long. The corresponding genomic sequence spans a region around 4653 bp on chromosome 3, and comprises six introns (
When aligned to GRAS domains of other rice proteins, OsAM18 clustered with putative SCARECROW proteins, remaining, however, as a separate branch (
The last 20 amino acids of OsAM18 were, in fact, poorly aligned to the other GRAS domains of the SCARECROW cluster, although the terminal part of the GRAS signature pattern W-x(10)-W was conserved (
It seems that OsAM18 has a peculiar sequence, which differentiates it from the other SCARECROW proteins.
Since the structure of the GRAS proteins does not reveal much about the biochemical function [
osam18 mutants showed a normal plant development, with shoot and root morphologies comparable to those of the WT plants (
To better investigate the role of OsAM18 during the presence of the AM fungus, we colonized WT and osam18 mutant plants with Funelliformis mosseae. Mycorrhizal osam18 mutant plants showed a significant reduced
shoot and root fresh weight compared to mycorrhizal WT plants (
50%) corroborating the reduction of AM colonization level. To investigate whether OsAM18 knock-out also affected arbuscule morphology, WT and osam18 mutant roots were stained with WGA-TRITC which detects the fungal cell wall and reveals the arbuscule morphology. Differently to the severe mycorrhizal phenotype detected in other mutated AM-marker GRAS genes, the osam18 mutant fungal structures had the same morphology observed in WT. Indeed, osam18 mutant displayed fully developed and highly branched arbuscules (
Taken together, these results demonstrated that the knock-out of OsAM18 gene led to a significantly reduced degree of mycorrhization but had no effect on the arbuscule morphology.
As a first hypothesis, the reduced colonization level could be related to the peculiar root system of rice, where a different susceptibility to AM fungi had been demonstrated [
The reason why the GRAS knock-out leads to a less successful symbiosis in the osam18 mutant remains elusive. On one hand the fungal growth is partially inhibited leading to a decreased presence of both hyphae and arbuscules; on the other hand the mutation has an impact on AM functionality not only at the level of cortical cells (decreased transcripts of OsPT11), but also at systemic level (decreased size and weight of shoots and roots from mycorrhizal mutant plants). Since the mutation in itself does not cause any clear change in the phenotype of the non-colonized plants, it seems that OsAM18 may act as a novel positive regulator of AM symbiosis: it could interact with some of the metabolic pathways which control plant growth response to AM fungi, like hormonal pathways or nutrient flow regulation. Moreover, we suggested that OsAM18 could be a component of the GRAS-domain proteins complex which is involved in the elicitation of AM symbiosis.
The authors express their thanks to Dr. Giampiero Valè and Mr. Gabriele Orasen for the support provided for plant growth and grains collection at CRA-RIS of Vercelli; and to Dr Marco Giovannetti for the useful discussion. Research was funded by the RISINNOVA Project (Grant No. 2010-2369, AGER Foundation) and the GreenRice Project (ERANET-FACCE), as well as VF and VV fellowship, respectively.
ValentinaFiorilli,VeronicaVolpe,SilviaZanini,MartaVallino,SimonaAbbà,PaolaBonfante, (2015) A Rice GRAS Gene Has an Impact on the Success of Arbuscular Mycorrhizal Colonization. American Journal of Plant Sciences,06,1905-1915. doi: 10.4236/ajps.2015.612191