Climate change is expected to unleash severe and frequent heat waves in future, adversely affecting crop productivity. The aim of this study was to examine the effect of two separate episodes of heat stress, mimicking heat wave conditions on the physiology of four Indian bread wheat cultivars and to study the ameliorating effects of epibrassinolide (BR) and calcium chloride on the recovery of these cultivars. The two thermo-tolerant cultivars C306 and K7903 suffered less inhibition of photosystem II efficiency as compared to the two thermo-susceptible cultivars HD2329 and PBW343. Application of BR and calcium chloride resulted in faster recovery in all the four cultivars. Measurement of the minimum fluorescence (Fo) versus temperature curves revealed a higher inflection temperature of Fo (Ti) for the two tolerant cultivars as compared to the susceptible cultivars, emphasizing greater thermo stability of the photosynthetic apparatus. The two thermo-tolerant cultivars showed higher photochemistry (ΦPSII) relative to the two susceptible cultivars. An increase in the steady state fluorescence was observed in both the susceptible cultivars as compared to the tolerant cultivars. Expression analysis revealed faster recovery of the transcripts involved in photosynthesis in tolerant cultivars as compared to susceptible cultivars. Exogenous application of the ameliorating compounds resulted in faster recovery of transcripts in all the cultivars. The result suggested that under severe stress conditions tolerant cultivars showed faster recovery and a better thermo-stability of its photosynthetic apparatus as compared to susceptible cultivars and application of epibrassinolide and calcium chloride could ameliorate the damaging effect of severe temperature stress to a considerable level in all the four cultivars under study.
Previous century has seen an increase of 0.74˚C in global mean temperature which currently continuing to increase at ~0.1˚C per decade [
Brassinosteroids (BR) are a group of steroids regulating plant growth and development by possible involvement in signaling pathways [
Apart from its role as a nutrient, calcium also acts as a secondary messenger and is known to ameliorate water stress induced effects in higher plants [
For simulation of two consecutive heat wave effect on the four Indian bread wheat cultivars namely C306, K7903, HD2329 and PBW343, potted plants at anthesis stage were taken for this study. The schematic diagram of the experiment designed is presented in
For Temperature Induction Response (TIR), 20 seeds of uniform size were imbibed for 16 h in petri plates with approximately 15 ml distilled water along with different chemicals including calcium chloride (CaCl2) (1 mM, 5 mM and 10 mM), Brassinosteroid (BR) (0.01 µM, 0.05 µM and 0.1 µM), salicylic acid (SA) (100 µM, 500 µM and 1000 µM), abcissic acid (ABA) (5 µM) and 1-aminocyclopropane-1-carboxylic acid (ACC) (100 µM). Seeds showing germination were subjected to lethal temperature stress of 51˚C for 3 h with prior induction at sublethal temperature of 37˚C for 1.5 h. Immediately after the treatment, seedlings were allowed to recover at 22˚C ± 1˚C. On the 10th day, from the date of imbibition of seeds, the percentage survival of seeds were scored [
Chlorophyll fluorescence parameters were measured continually in situ from D-0 to D-5 with Licor 6400
(Portable Photosynthesis System, Li-Cor, Lincoln, NE, USA). For measuring Fm, dark adapted leaves were given a 0.8 s saturating pulse at 8000 µmol m−2 s−1 after 30 min of dark adaptation. After recording steady state fluorescence, a second 0.8 s saturating light of 8000 µmol photons m−2s−1 was provided to determine the maximum fluorescence in the light-adapted state (Fm'). After turning off the actinic light, 3 s of far red light was followed by noting the minimal fluorescence in the light-adapted state (Fo'). The following parameters were then calculated: Fv/Fm = Fm − Fo/Fm; ɸPSII = Fm' − Fo'/Fm'; ETR = ɸPSII × PPFD × A × 0.5; qP = Fm' − Fs/Fm' − Fo'; ɸNPQ = (Fs/Fm') − (Fs/Fm); ɸf, d = Fs/Fm. The inflexion temperature and the peak temperature were determined by using Junior PAM-250 (WALZ, Germany). Dark adapted leaf disc were kept in water bath of 25˚C - 60˚C and readings were taken after every degree rise in temperature.
Total chlorophyll was estimated fluorometrically by taking 100 mg leaf tissue in 20 ml of dimethylsulphoxide (DMSO) at 65˚C for 4 h in dark and total chlorophyll content was calculated [
Membrane Injury Index was measured with 100mg fresh leaf tissue in 20 mL milli-Q water per tube. Electrical conductivity (EC) was measured with an EC-meter (Eutech, Singapore). Test tubes were autoclaved for 10 min at 0.10 MPa pressure to release all the electrolytes. Final EC was measured after bringing down the temperature to 25˚C. Percentage Relative Injury Index (RII %), was than calculated [
Total RNA was isolated from control and treated samples using the RNeasy Plant mini kit (Qiagen, Germany) according to the manufacturer’s instructions, followed by on-column DNase I treatment to remove genomic DNA contamination. 1.5 µg of the total RNA was used as template for cDNA synthesis employing the High Capacity cDNA Archive kit (Applied Biosystems, USA) and mixed with 200 nM of forward and reverse primers (
The mature spikes having fully developed grains were harvested from experimental and control plants and 100 seed weight was measured.
Heat Susceptible Index was calculated [
All experiments were carried out with at least 3 biological replicates. Results were analyzed by one-way ANOVA to identify significant differences between the groups and their significance levels (p < 0.05) were determined.
Terminal heat stress can substantially reduce grain yield depending upon the cultivar in wheat. Previous reports have shown the positive impact on grain yield upon application of various compounds. Hence in this study, the role of different compounds in ameliorating the negative effect of high temperature stress was investigated.
A tolerant (CPAN1676) and susceptible (HD2428) cultivars were selected based on their thermotolerance performance studied earlier in the lab. Different compounds were checked for their ameliorating effect, including Calcium Chloride (CaCl2), Abscisic acid (ABA), Salicylic acid (SA), Brassinosteroid (BR), and 1-aminocyclo- propane-1-carboxylic acid (ACC) which were previously reported to be providing thermotolerance to plants. Hence we have used different concentrations for optimization of ameliorating effect, if any, on heat stress in wheat cultivars.
Seeds were imbibed for 16 h with or without ameliorating compounds. Application of calcium chloride at
Gene | Primer | Sequence (5'-3') |
---|---|---|
Ascorbate peroxidase | F | ATGCGCCCCCATCATG |
R | CACCAGTTCTTGTGTTCACATCATAG | |
Rubisco Large subunit | F | AACGAAGGGCGCGATCTT |
R | CATTTGCAAGCTGCTCGGATA | |
Rubisco small subunit | F | CCTTCTCCTTGTGTTAGCATCGA |
R | TTGCACGGATGACCATTAGG | |
Oxygen evolving complex | F | AGCCGCTCATCGACAAGAA |
R | CCTGAGGCGGAGGTCGTT | |
PsbO | F | AGGCCGAGGGCATCCA |
R | ACGGGTCATGAGCTTGGTTT | |
PsbP | F | AAGGCGCAACGAGACAAGAG |
R | CGGCGTTCTCGACGAACTT | |
Actin | F | CCTTGTTTGCGACAATGGAA |
R | AGCCCTTGGTGCATCATCTC |
various concentration (1 mM, 5 mM and 10 mM) showed an increase in percentage survivability of imbibed seeds as compared to imbibed heat treated seeds with temperature stress at 37˚C/1.5 h followed by 51˚C for 3 h (
Treatment with different concentrations of Brassinosteroid (BR) (0.01 µM, 0.05 µM and 0.1 µM) showed a concentration of 0.01 µM to be most effective in imparting thermotolerance to seedlings following lethal temperature stress (
Heat treated plants showed a percentage decrease in survival of 27.5% and 75% for CPAN1676 and HD2428 whereas BR (0.01 µM) treated seeds showed a decrease in percentage survivability of 7.5% and 55% for CPAN1676 and HD2428, respectively (
Out of the different concentrations (100 µM, 500 µM and 1000 µM) of salicylic acid, a concentration of 100 µm showed a slightly better performance as compared to heat treated germinating seeds (
Abscisic acid (ABA) at a concentration of 5 µM showed dramatic increase in percentage survivability in CPAN1676 reaching upto 97.5% whereas HD2428 showed a lower survivability percentage of 50% in ABA treated germinating seeds, whereas heat treated germinating seeds showed a percentage survival of 27.7% and 77.5% for CPAN1676 and HD2428, respectively (
1-aminocyclopropane-1-carboxylic acid (ACC) at a concentration of 100 µM was used and the treated plants showed better recovery in terms of percentage decrease in survivability with heat treated plants showing a percentage decrease in survival of 27.5% and 77.5% in CPAN1676 and HD2428, respectively, whereas ACC treated germinating seeds showed a percentage decrease in survival of 12.5% and 52.5% in CPAN1676 and HD2428, respectively (
Since treatment with CaCl2 and BR increased the percentage survival of germinating seeds, both these compounds were used approximately a day before anthesis to check their ameliorating effect after heat treatment. Hence we have used CaCl2 at a concentration of 10 mM and Brassinosteroid (BR) at a concentration of 0.05 µM, since BR at a concentration of 0.01 µM did not showed optimal results in mature plants. This was probably due to the limitation in BR entry inside the plant through the surface upon foliar spray. The experiment was designed over a span of 5 days, with moderate temperature stress of 37˚C/1 h followed by high temperature stress of 43˚C for 8 h were given on D-1 and D-3. D-2, D-4 and D-5 are the recovery period at 22˚C ± 1˚C. Schematic representation of the experimental design along with the recovery plants on day 5 are shown in
In mature plants, high temperature has profound effect on photosynthetic yield measured as fluorescence efficiency (Fv/Fm) (
The minimum fluorescence (Fo) showed a small increase after thermal stress on D-1 and D-3 in all cultivars, although the increase was slightly higher in HD2329 and PBW343 as compared to C306 and K7903 (
A steep increase in Fo was observed on D-4, in all cultivars, with sensitive cultivars HD2329 and PBW343 showing higher Fo values as compared to the tolerant cultivars C306 and K7903. All except HD2329 showed recovery by D-5, with treated plants showing faster recovery, HD2329 showed an increasing trend in Fo which reached to maximum level by D-5 with the treated plants too showing a similar trend. A slight decrease in Fo was observed in treated plants as compared to HS, suggesting irreversible damage to chloroplast membrane (
Thermal stress induced injury to PSII have been earlier shown [
Additionally, both ɸPSII and ETR showed a consistent decrease in efficiency after high temperature treatment (
The BR and CaCl2 treated plants showed stability by D-5 as compared to HS plants in HD2329. This suggests that treated plants had undergone relatively lesser injury as compared to non-treated plants. The faster recovery in treated plants results in better energy utilization, which over the span of the growing season adds to a significant increase in yield. Excess energy dissipated thermally is a photo protective mechanism in plants.
Energy partitioning model have earlier been proposed by giving insight into the energy assimilation and dissipation mechanism for protecting photosynthetic apparatus [
High temperature induced injury results in an imbalance between energy absorption and utilization. The energy not utilized in carbon assimilation can be easily directed in formation of Reactive Oxygen Species (ROS) which further degrades the photosynthetic apparatus [
Non photochemical quenching regulated by thylakoid lumen pH and PsbS showed a significant increase in all the four cultivars with HD2329 showing maximum increase in NPQ by D-5 (
In fact HD2329 showed a maximum increase in ɸf, d by D-5 suggesting damage to photosynthetic apparatus and chlorophyll, hence affecting energy absorption and utilization. Further, ɸNPQ which depicts the fraction of the regulated ΔpH and xanthophyll dependent thermal dissipation process (ɸNPQ), showed an increase after D-1 and D-3 and by D-5 showed different levels of increase in C306, K7903, HD2329 and PBW343 (
These results indicate that C306 and K7903 are more efficient in regulating energy partitioning in PSII complexes to minimize damaging potential simultaneously retaining the efficiency for carbon assimilation. The effective energy partitioning could possibly be contributing to acclimation mechanism by withstanding higher temperatures in C306 and K7903.
Decrease in qP (Photochemical quenching by PSII) was observed after D-1 and D-3 of heat stress, by D-5 all cultivars except HD2329 showed stability in qP. A consistent decrease in qP was observed in HD2329, although BR and calcium chloride heat stress treated plants showed comparatively stable qP by D-5 in HD2329 (
Following treatment, all cultivars showed faster recovery as compared to heat stressed plants. Estimation of redox state of QA, the first molecule that accept electron from PSII in z-scheme, using lake model presuming all photosynthetic units are connected [
To measure the thermo-stability of the photosynthetic membranes, Fo versus T curves in the leaves of all four cultivars were measured (
For better efficiency of the photosynthetic apparatus, better membrane stability is advantageous. Increase in Fo in the dark under increasing temperature conditions (Fo versus T curve) has been frequently used to determine the thermo-stability of the photosynthetic apparatus [
The total chlorophyll content in both C306 and K7903 showed a slight dip on D-1 and D-3 but showed complete recovery by D-5. K7903 showed higher chlorophyll accumulation by D-5 as compared to control. In contrast, both HD2329 and PBW343 showed a continuous decrease in total chlorophyll. Although in all four cultivars, higher levels of chlorophyll was observed in BR and calcium chloride treated plants (
Membrane Injury Index has been widely used in identification of tolerant members of specie, highlighting the degree of damage to membrane. High temperature induced increase in membrane fluidity resulted in an increase in membrane leakage rate of all the four wheat cultivars after D-1 and D-3 of HS. Although by D-4, both C306 and K7903 started showing lower membrane injury and by D-5 showed nearly complete recovery (
Similar trend in MII was observed with BR and calcium chloride treated plants. HD2329 showed an increase in MII on D-4, which further increased on D-5, HD2329 treatment given plants with both the ameliorating agents too showed similar trend as of HS plants, with increase in membrane injury of 303 fold, 229 fold and 281 fold in HS, BR and CaCl2 treated plants, respectively. In PBW343 HS, BR and calcium chloride treated plants a
similar increase in MII as HD2329 on D-4 was observed but started showing stability by D-5, with BR and CaCl2 treated plants showing slight decrease in injury as compared to HS (
The 100-seed-weight showed a higher percentage decrease in seed weight in susceptible cultivars HD2329 and PBW343 as compared to the two tolerant cultivars C306 and K7903 (
A substantial decline in the expression of all photosynthetic genes were observed in all cultivars immediately after heat stress, although the decrease in tolerant cultivars was slightly lower as compared to the two susceptible cultivars and faster recovery in the expression of the transcripts of all genes was observed in the tolerant cultivars along with treated plants of the four cultivars (
Expression analysis by real time PCR revealed a decrease in the expression of all photosynthetic genes in all cultivars after temperature stress on D-1 and D-3. For all genes under study namely rubisco large and small subunit, PsbO, PsbP, oxygen evolving complex and ascorbate peroxidase, both the tolerant cultivars showed faster recovery in expression of these genes as compared to the two susceptible cultivars. Faster recovery was also observed in all cultivars after treatment with BR and calcium chloride (
Further to determine the thermos-tolerance level of all the four cultivars, Heat Susceptibility Index (HSI) was estimated (
Heat Susceptibility Index for heat treated HD2329 was maximum, although with BR and CaCl2 treatment HD2329 showed a decrease in HSI. Minimum HSI was shown by treated plants of K7903. Different cultivars responded differently to the ameliorating agents. Although C306 and HD2329 showed lower HSI with CaCl2, whereas K7903 showed low HSI with BR (
Earlier reports [
The adverse effect of thermal stress on PSII had earlier been reported [
Estimation of reduced state of QA based on Puddle model reflect the reaction centres that are open and had been commonly used to indicate the onset of photo inhibition [
The minimum fluorescence has been extensively used in thermo-stability of the photosynthetic apparatus [
found K7903 and C306 exhibited a higher Ti than the two thermo-susceptible cultivars HD2329 and PBW343 suggesting that K7903 and C306 have better thermo-stability of its photosynthetic apparatus as compared to the two thermo-susceptible cultivars HD2329 and PBW343.
High temperature induced photo inhibition result in an imbalance in light energy absorption and utilization. The energy not utilized can result in the formation of free radicals, which can damage the photosynthetic apparatus [
Cellular membrane are the chief sites for physiological injury by high temperature [
Lower decrease in 100-seed-weight was observed in thermo-tolerant cultivars as compared to thermo-sus- ceptible cultivars after heat treatment. Upon application of ameliorating agents, considerable increase in 100- seed-weight was observed in all cultivars. Increased yield in treated plants can be correlated with the better photosynthetic activity, since addition of ameliorating agents invariably resulted in an increase in PSII efficiency and ultimately photosynthetic yield. Any increase in photosynthetic activity will contribute to the assimilatory efficiency of plant, and hence will improve yield in terms of grain weight.
Light energy distribution showed different level of energy utilization between different cultivars. Whereas both the tolerant cultivars C306 and K7903 showed only a slight increase in ɸf, d (Constitutive thermal dissipation), and ɸNPQ (non photochemical quenching) by D-5, HD2329 showed a significant increase in both ɸf, d and ɸNPQ, although PBW343 showed stability in ɸf, d and ɸNPQ by D-5. The increase in ɸf, d in HD2329 highlight the damaging effect of high temperature stress on the thylakoid membrane and thus resulting in a decrease in efficiency in energy utilization via PSII complexes and hence an increase in damage to carbon assimilation pathway.
A decrease in the transcripts level of genes involved in the process of photosynthesis was observed. A decrease in photosynthesis can possibly be an adaptive mechanism for high temperature tolerance in plants. Shut down of the carbon assimilation can possibly aid in imparting thermotolerance to plants by keeping a strong proton motive force, thus preventing membrane collapse. In addition, rubisco deactivation can avert photorespiration under conditions of high temperature and thus preventing the formation of phosphoglycolate and omit the carbon that could be fixed.
Environmental stress inducing ROS production triggers enhancement in APX expression [
Various studies have highlighted BR induced abiotic stress tolerance in plants [
Transient Ca2+ peaks have been observed across the plasma membrane during heat stress, corroborating the role of heat stress sensing by plasma membrane [
Increased expression of Cam3 and Cam7 is observed during thermal stress resulting in expression of HSPs [
In our study, we have observed that application of BR and CaCl2 on plants before heat stress can decrease the injury level and increase the recovery after heat stress. Faster recovery after heat stress in all the cultivars based on the florescence observation along with membrane injury index, total chlorophyll content and faster recovery of genes involved in photosynthesis points towards the ameliorating effect of BR. Further, higher seed weight observed in treated plants points towards the significance of these compounds in ameliorating the negative effect of heat treatment and an overall increase in grain yield.
In conclusion, the two thermo-tolerant cultivars, C306 and K7903 performed better under high temperature treatment as compared to the two thermosensitive cultivars HD2329 and PBW343. Exogenous application of Brassinosteroid and calcium chloride resulted in faster recovery in all the four cultivars.
This work was financially supported by Department of Biotechnology, Government of India, and partially by Indo-Swiss Collaboration in Biotechnology (ISCB). SH thanks Council for Scientific and Industrial Research for Junior and Senior Research Fellowships.
SubootHairat,ParamjitKhurana, (2015) Improving Photosynthetic Responses during Recovery from Heat Treatments with Brassinosteroid and Calcium Chloride in Indian Bread Wheat Cultivars. American Journal of Plant Sciences,06,1827-1849. doi: 10.4236/ajps.2015.611184