Bipolaris oryzae is the causal agent of brown spot disease in rice and produces the dark pigment melanin. We isolated and characterized
T4HR1 gene encoding 1,3,6,8-tetrahydroxynaphthalene (1,3,6,8-THN) reductase, which converted 1,3,6,8-THN to scytalone in the melanin biosynthesis from
B. oryzae. A sequence analysis showed that the
T4HR1 gene encoded a putative protein of 268 amino acids showing 50% - 99% sequence identity to other fungal 1,3,6,8-THN reductases. Targeted disruption of the
T4HR1 gene showed a different phenotype of mycelial color due to an accumulation of shunt products compared to those of wild-type on PDA plates using tricyclazole as a melanin biosynthesis inhibitor. A quantitative real-time PCR analysis showed that the expression of
T4HR1 transcripts was enhanced by near-ultraviolet (NUV) irradiation and regulated by transcriptional factor
BMR1, similar to three other melanin biosynthesis genes (polyketide synthase gene [
PKS1], scytalone dehydratase gene [
SCD1], and 1,3,8-THN reductase gene [
THR1]) in the melanin biosynthesis of
B. oryzae. These results suggested that common transcriptional mechanisms could regulate the enhanced gene expression of these melanin biosynthesis genes by NUV irradiation in
B. oryzae.
Melanin is a dark-pigmented polymer that protects organisms against environmental stress, and its production is also widespread in the fungal kingdom [1] -[3] . In general, melanin accumulates in fungal cell walls and has been believed to confer tolerance to environmental stresses such as UV radiation [4] -[7] . In fungi, light modulates processes, such as the reproduction structures and pigment biosynthesis, and the molecular bases of fungal photoreceptors as well as those of photomorphogenesis by blue and red light, have been widely studied as detailed in a number of published reviews [8] -[12] .
Bipolaris oryzae (Breda de Haan) Shoemaker [anamorph of the ascomycetous fungus Cochliobolus miyabeanus (Ito et Kuribayashi) Drechslerex Dastur], the causal agent of brown leaf spot disease in rice, produces 1,8- dihydroxynaphthalene (DHN)-melanin [13] [14] , and it produces its asexual spores (conidia) by the induction of near-ultraviolet irradiation [15] [16] . DHN-melanin biosynthesis in B. oryzae starts with a polyketide synthaseusing acetate as a precursor (Figure 1). A hydroxynaphthalene reductase converts 1,3,6,8-tetrahydroxynaph- thalene (1,3,6,8-THN) to scytalone. The dehydration of scytalone by scytalone dehydratase forms 1,3,8-trihy- droxynaphthalene (1,3,8-THN). 1,3,8-THN reductase converts the 1,3,8-THN to vermelone, which is further dehydrated to 1,8-DHN. Finally, the oxidative polymerization of 1,8-DHN gives DHN-melanin. We have identified polyketide synthase gene (PKS1) [17] , scytalone dehydratase gene (SCD1) [18] , and 1,3,8-THN reductase gene (THR1) [19] in B. oryzae and observed that the expression of these melanin biosynthesis genes was specifically enhanced by near-ultraviolet (NUV: 300 - 400 nm) irradiation. The 1,3,6,8-THN reductase gene has not
The melanin biosynthesis pathway of Bipolaris oryzae. PKS1, polyketide synthase gene (AB176546); T4HR1, 1,3,6,8-tetrahydroxynaphtha- lene reductase gene (AK424235, in this study), SCD1, scytalone dehydra- tase gene (AB100172); THR1, 1,3,8-trihydroxynaphthalene reductase gene (AB083402). Open arrows and dotted arrows indicate the main and shunt pathways, respectively. Tricyclazole inhibits T3HN reductase activity. DDN, 3,4-dihydro-4,8-dihydroxy-1(2H)naphthalenone
yet been identified and characterized in B. oryzae, although 1,3,6,8-THN reductase genes have been identified and characterized in Magnaporthe grisea [20] [21] , Colletotrichum orbiculare [22] , Sordaria macrospora [23] , and Cochliobolus heterostrophus [24] .
In previous studies, to reveal the mechanisms underlying the photomorphogenetic response to NUV irradiation in B. oryzae, we focused on the regulatory genes induced by NUV irradiation, and we reported that NUV irradiation specifically enhanced the expression of a novel NUV-inducible gene (UVI-1) [25] and the photolyase gene [26] . Recently, we also reported 46 newly identified genes that were enhanced by NUV irradiation in B. oryzae, following our use of suppression subtractive hybridization methods [27] . Interestingly, one of the 46 genes, NUV12, showed significant similarities to 1,3,6,8-THN reductase in some fungi, as mentioned above.
Here we reported the cloning of a 1,3,6,8-THN reductase gene (T4HR1) from B. oryzae. We also demonstrated that the expression of the T4HR1 was enhanced by NUV irradiation and was dependent on the transcription factor BMR1, which was similar to the expressions of three other melanin biosynthesis genes in B. oryzae.
2. Materials and Methods2.1. Fungal Strains and Growth Conditions
Bipolaris oryzae strain D9/F6-69 and ∆BMR1 (stock culture at the Laboratory of Plant Pathology, Shimane Uni- versity) were used as the wild-type and BMR1 disruptant strain [28] , respectively. The experimental fungus was grown on potato dextrose agar (PDA) in 9-cm petri plates (Iwaki, Tokyo, Japan). The plates were inoculated centrally with a mycelial plug. The cultures were incubated at 25˚C ± 1˚C for 4 days in continuous darkness and then subjected to light treatments. Black-light (BLB) lamps (FL-BLB; Toshiba Electric, Tokyo, Japan), which emitted wavelengths of 300 to 400 nm (mainly 352 nm), were used as the source of NUV radiation. The irradiance of NUV radiation was measured by an USB4000-UV-VIS miniature fiber optic spectrophotometer (Ocean Optics, Dunedin, FL, USA). The average irradiance of the NUV radiation was 280 mW∙m−2.
2.2. Cloning and Sequence Analysis of T4HR1 Gene
Genomic DNA was extracted from mycelia grown in potatodextrose broth as described [25] . The target DNA of NUV17 was amplified by polymerase chain reaction (PCR) and purified using the NucleuSpin Gel and PCR Clean-up kit (Macherey-Nagel, Düren, Germany). A cDNA library constructed in the λgt10 vector was screened using a digoxigenin (DIG)-labeled NUV17 fragment from B. oryzae. DNA labeling, hybridization and detection were carried out using a nonradioactive system (Roche Diagnostics, Mannheim, Germany) according to the manufacturer’s instructions. Sequencing reactions were performed using the BigDye® Terminator v3.1 Cycle Sequencing Kit (Life Technologies, Carlsbad, CA) according to the manufacturer’s instructions. The DNA sequence analysis was performed on an ABI PRISM 310 genetic analyzer (Applied Biosystems, Foster City, CA). Both strands were completely analyzed by overlapping at every junction. A computer analysis of the DNA sequence data was performed using GENETYX®-Mac (GENETYX Co., Tokyo, Japan). Comparisons between DNA and the predicted aminoacid sequence and a phylogenetic analysis were carried out using the BLAST and CLUSTALW network programsat the DNA Data Bank of Japan (DDBJ, http://www.ddbj.nig.ac.jp).
2.3. Disruption of T4HR1 Gene
The T4HR1 gene deletion vector was constructed based on the double-joint PCR strategy [29] -[31] as shown in Figure 2(a). Fragment t4hr1 A (left side, 397-bp) and Fragment t4hr1 B (right side, 415-bp) of the T4HR1 locus were amplified from B. oryzae genomic DNA using primers T4HRAF/T4HRAR and T4HRBF/T4HRBR, respectively. A 3.0-kb hph cassette (PtrpC-hph-TtrpC) containing hygromycin-resistant gene was also amplified from pSH75 [32] with primers T4HRfushpF/T4HRfushpR. The PCR was performed using KOD Plus DNA polymerase (Toyobo Life Science, Tokyo, Japan) and a Thermal Cycler Gene Atlas (Astec, Fukuoka Japan). These amplified fragments were joined together in the second-round PCR using TaKaRa EX Taq HS (TaKaRa Bio, Otsu, Japan), the product of which acted as the template for the final amplification with primers T4HRAF/ T4HRBR. The final 3.8-kb double-joint PCR product (T4HR1 disruption fragment) was purified using the NucleuSpin Gel and PCR Clean-up kit before transformation. The wild-type strain D9/F6-69 was transformed with the 3.8-kb double-joint PCR productas described [19] . Transformants were selected on PDA containing 100 µgmL−1 hygromycin B (Wako Pure Chemical Industries, Osaka, Japan).
Targeted disruption of T4HR1. (a) Strategy of targeted disruption. Fusion PCR was used to construct the T4HR1 gene replacement fragment. The sequences of these primers are listed in Table 1. Predicted structures of the T4HR1 locus before (WT genomic DNA) and after homologous recombination (disruptant genomic DNA) are also indicated. (b) PCR analysis of gene replacement in T4HR1 in wild-type (WT) and T4HR1 disruptants (GD1 and GD2). Each PCR was carried out using the primer pair indicated in the parentheses. The sequences of these primers are also listed in Table 1
2.4. Quantitative Real-Time PCR Analysis
Colonies grown on a PDA medium for 4 days in darkness were exposed to BLB light as a source of NUV radiation for 1 h. To peel off the mycelia from the agar medium, the agar surface of a petri plate (15 mL PDA) was overlaid with a single layer of dialysis tubing (8 cm in flat width; EIDIA Co., Tokyo, Japan) that had been autoclaved at 121˚C for 15 min. Mycelia were scratched from dialysis tubes by a sterilized stainless steel spatula, frozen in liquid nitrogen, and ground with a mortar and pestle to a fine frozen powder. Total RNA was isolated from the frozen mycelial powder by phenol/chloroform extraction, followed by LiCl precipitation according to the published protocols [33] . DNA contamination was eliminated by treatment with RNase-free DNase I (TaKaRa Bio). cDNA was prepared from the total RNA as a template using Ready-To-Go You-prime First-Strand Beads (GE Healthcare UK, Buckinghamshire, UK) with anoligo (dT)15 primer (Promega, Madison, WI). Real- time PCR was performed using SYBR Premix Ex Taq II (TaKaRa Bio) and a Thermal Cycler Dice Real-Time System TP800 (TaKaRa Bio). The primers used in the reaction (Table 1) were designed by Primer3 at the website http://frodo.wi.mit.edu. The PCR conditions were as follows: initial denaturation (95˚C, 20 sec), followed by 40 cycles of denaturation (95˚C, 5 sec) and annealing/extension (60˚C, 30 sec) according to the manufacturer’s instructions. Post-PCR melting curves confirmed the specificity of single-target amplification, and the fold expression of each gene relative to the glyceraldehyde-3-phosphate dehydrogenase gene (GPD) was determined.
3. Results and Discussion3.1. Cloning of the 1,3,6,8-THN Reductase Gene from B. oryzae
Using suppression subtractive hybridization, we previously identified 46 genes (NUV01-NUV46) whose expressions were enhanced by NUV irradiation in B. oryzae [27] . Among these clones, a 363-bp fragment of NUV12 showed similarity to other fungal 1,3,6,8-THN reductases. Thus, we screened the cDNA library of B. oryzae using the DIG-labeled 363-bp fragment as a probe by plaque hybridization. From about 50,000 plaques, three positive clones were identified. One of the phage clones, designated cT4HR1, was sequenced and the cloned cDNA was designated T4HR1 (DDBJ Accession No. AK424235). The T4HR1 gene contained an open reading frame (ORF) encoding 268 amino acids.
To confirm the existence of an intron of the T4HR1 gene, we also screened the genomic library of B. oryzae, using the DIG-labeled T4HR1 cDNA probe by colony blot hybridization. One positive clone was isolated and named pUCT4HR1. A comparison of both sequences of the T4HR1 cDNA and the genomic DNA revealed no intron (data not shown). A Southern blot analysis showed that the T4HR1 gene was present as a single copy in the B. oryzae genome (data not shown).
PCR primers used in this study
Gene
Primer name
Sequence (5’ to 3’)
T4HR1
T4HRAF
GGTCGTCACAGTACCCACTG
T4HRAR
GGAACAACTGGCATGAATTCTGACCAACGAAGAATTGC
T4HRBF
TCCTTCTTTCTAGAGGATCCATTGAGGATAACGGCCGTA
T4HRBR
CCCATCTTCTGACACCACAC
T4HRfushphF
GCAATTCTTCGTTGGTCAGAATTCATGCCAGTTGTTCC
T4HRfushphR
TACGGCCGTTATCCTCAATGGATCCTCTAGAAAGAAGGA
T4HRF*
ATTGAGGATAACGGCCGTAT
T4HRR*
AGCGTGGTCCTTGACACCAA
PKS1
PKS17002F*
GACCCAGCTCCCATGAAGTG
PKS17196R*
ACCGTGATCCCCCTTCATC
SCD1
SCD69F*
GGAGGTGATGGGCTGTCAA
SCD188R*
TCCAGTCCTTGCTGTCGTA
THR1
THR481F*
GATTGGTGGCCGTATCATCCT
THR685R*
ACCTTCTTCTCACCAGCATCGA
PtrpC
PtrpCR
CCGAGTTTGTTTCGGAGAAG
TtrpC
TtrpCF
CCTGGGTTCGCAAAGATAAT
hph
hphF
ATGAAAAAGCCTGAACTCACCG
hphR
CTATTCCTTTGCCCTCGGACGA
GPD
GPD161F*
AACGGCAAGACCATCCGTT
GPD241R*
GACGACGTAGTAAGCGCCAGT
*Primers used in the quantitative real-time PCR analysis.
3.2. Comparison of the Predicted T4HR1 Protein Sequence with Those of Other Fungal 1,3,6,8-THN Reductases
The deduced amino acid sequence of T4HR1 revealed high similarity to the fungal 1,3,6,8-THN reductase involved in the melanin biosynthesis of Cochliobolus heterostrophus [24] , Setosphaeriaturcica (EU494943), Neurospora crassa (Q7S3E8), Sordaria macrospora [23] , Colletotrichum orbiculare [22] , and Magnaporthe grisea [20] [21] , all of which produce DHN melanin (Figure 3). These sequence similarities among the predicted T4HR1 protein of B. oryzae and other fungal 1,3,6,8-THN reductases suggest that the predicted T4HR1 protein of B. oryzae may have the same function as other fungal 1,3,6,8-THN reductases in melanin biosynthesis.
Comparison of the deduced amino acid sequence of the B. oryzae T4HR1 (Bo) with those of other fungal 1,3,6,8-THN reductases. Ch: Cochliobolus heterostrophus (EF060260); St: Setosphaeriaturcica (EU494943); Nc: Neurospora crassa (Q7S3E8); Sm: Sordaria macrospora (AM493725); Co: Colletotrichum. orbiculare (AB661336); Mg: Magnaporthe grisea (AF290182). Perfectly conserved and well-conserved positions in the alignment are indicated by an asterisk (*) and a dot (.), respectively. Similarity (% identity) of the deduced amino acids sequence of the B. oryzae T4HR1 (Bo) and those of other fungal 1,3,6,8-THN reductases are indicated in parentheses at the end of each amino acid sequence
3.3. Disruption of the T4HR1 Gene
We investigated the effects of disrupting T4HR1 in B. oryzae using transformation-mediated gene disruption (Figure 2(a)) as described [29] -[31] . As a result, three transformants, named GD1, GD2 and GD3, were isolated and two transformants were selected to examine homologous integration by a PCR procedure (Figure 2(b)). The T4HR1 fragment (0.8 kb) was amplified using the primer pair T4HRAF/T4HRBR in the wild-type but not in GD1 and GD2 transformants. In contrast, Fragment A (0.6 kb), hph (1.0 kb), and Fragment B (6.7 kb), all of which are involved in the T4HR1 disruptant fragment, were amplified in the GD1 and GD2 transformants but not in the wild-type with the primer pairs T4HRAF/PtrpCR, hphF/hphR and TtrpCF/T4HRBR, respectively. These results suggested that T4HR1 gene was deleted by the homologous integration of the T4HR1 disruption fragment in the GD1 and GD2 transformants.
In our previous work, the disruption of each of the melanin biosynthesis genes PKS1, SCD1, and THR1 resulted in an albino phenotype in B. oryzae [17] -[19] . However, the mycelial color on PDA medium was not different between the wild-type and the T4HR1 disruptants (Figure 4). The DHN melanin biosynthesis pathway has two reduction steps: the conversion of T4HN to scytalone and the conversion of T3HN to vermelone (Fig- ure 1). In M. grisea and C. orbicurare, it is known that T3HN reductase converts both reduction steps [21] [22] . Thus, the conversion of T4HN to scytalone could progress by T3HN reductase with or without T4HN reductase in B. oryzae, and the T4HR1 disruptants could produce melanin as well as the wild-type. To confirm the deficiency of T4HN reductase activity in the T4HR1 disruptants, we observed the mycelial color on PDA agar using tricyclazole as an inhibitor of T3HN reductase. A muddy orange color was observed in the wild-type, suggesting that shunt products, 2-hydroxyjuglone and DDN, could accumulate in the wild-type (Figure 4) due to the inhibition of the T3HN reductase activity (Figure 1). In contrast, a vivid orange color was observed in the T4HR1 disruptants (Figure 4). These results suggested that the shunt products, flaviolin and 3,3-biflabiolin, could accumulate in the T4HR1 disruptants, because the conversion of T4HN to scytalone was completely blocked due to the lack of T4HN reductase and the inhibition of T3HN reductase in the T4HR1 disruptants. However, the elucidation of these shunt products must be addressed in future studies to confirm this speculation.
3.4. T4HR1 Expression under NUV Irradiation
We examined the time-course of the expression of the T4HR1 transcripts compared with those of PKS1, SCD1, and THR1 transcripts under NUV irradiation by performing a quantitative real-time PCR. We found that the T4HR1 transcription level increased with increasing NUV irradiation time, similar to the time-course of three other melanin biosynthesis genes, PKS1, SCD1 and THR1 (Figure 5). These results suggest that the expression of T4HR1 gene is enhanced by NUV irradiation, as is the expression of other melanin biosynthesis genes, PKS1, SCD1 and THR1, and common mechanisms regulate the transcription of these melanin biosynthesis genes. In our previous work, we found that the BMR1 gene encoding a transcriptional factor for melanin biosynthesis was essential for the transcription of three melanin biosynthesis genes, PKS1, SCD1 and THR1 [28] . Thus, in the present study we further examined whether T4HR1 gene expression was affected in the BMR1 disruptant (Figure 6). In the wild-type strain, T4HR1 gene was expressed in darkness and was significantly enhanced in mycelia
Growth of the wild-type (WT) and T4HR1 disruptants (GD1 and GD2) on a PDA plate with (+) or without (−) tricyclazole (100 µM)
Time-course expression of the melanin biosynthesis genes under NUV irradiation. Mycelia grown for 4 days in darkness were transferred under NUV irradiation and harvested at the time indicated. The primers used in this experiment were as follows: PKS1: PKS7001F/PKS7196R; T4HR1: T4HRF/T4HRR; SCD1: SCD69F/SCD188R; THR1: THR481F/ THR685R; GPD (for internal control): GPD161F/GPD241R. The sequences of these primers are listed in Table 1. The expression was normalized by dividing the average value of GPD as the internal control. The relative changes in each mRNA expression were determined as fold changes relative to a dark control (=1). Vertical bars: std. dev
Expression of the melanin biosynthesis genes in the wild-type (WT) and BMR1 disruptant (∆BMR1). Mycelia grown for 4 days in darkness (dark) were exposed to NUV irradiation for 1 h (NUV), and total RNA was extracted. The primers used in this experiment were: PKS1: PKS7001F/PKS7196R; T4HR1: T4HRF/T4HRR; SCD1: SCD69F/SCD188R; THR1: THR481F/THR685R; GPD (for an internal control): GPD161F/GPD241R. The sequences of these primers are listed in Table 1. The expression was normalized by dividing the average value of GPD as the internal control. The relative changes in each mRNA expression were determined as fold changes relative to a dark control (=1). Vertical bars: std. dev
exposed to NUV irradiation. In the BMR1 disruptant, the expression level of T4HR1 was reduced by approx. 100-fold compared to that of the wild-type in the dark (Figure 5). In addition, enhanced gene expression of T4HR1 by NUV irradiation was not observed in the BMR1 disruptant. These expression patterns were similar to those of the other three melanin biosynthesis genes, PKS1, SCD1 and THR1 (Figure 6). These results suggest that the transcriptional factor BMR1 could be essential for constitutive expression in the dark and for the NUV irradiation-enhanced expression of T4HR1 as well as the other melanin biosynthesis genes PKS1, SCD1 and THR1. We previously observed that the expression of the BMR1 transcripts was also enhanced in mycelia exposed to NUV irradiation and over expression of the BMR1 gene enhanced melanin biosynthesis under dark conditions through high expression levels of the melanin biosynthesis genes [28] . Thus, the NUV irradiation- enhanced BMR1 expression would lead to an accumulation of the transcriptional factor BMR1, resulting in enhanced expression of the PKS1, T4HR1, SCD1 and THR1 transcripts by NUV irradiation.
We previously isolated and characterized the Blue-light regulator 1 (BLR1) gene, which encodes a putative blue/UVA-absorbing photoreceptor similar to white collar 1 (WC-1) of Neurospora crassa in B. oryzae [34] . In addition, it suggested that the BLR1 protein was necessary not only for conidial formation but also for NUV radiation-enhanced photolyase gene expression in B. oryzae [34] . Enhanced gene expression of T4HR1 by NUV irradiation was also observed in the BLR1 disruptant [27] , suggesting that the expression of melanin biosynthesis genes could be regulated by another putative NUV-absorbing photoreceptor which was distinct from the regulation by BLR1 as a blue/UVA-absorbing photoreceptor.
4. Conclusion
We identified the 1,3,6,8-tetrahydroxynaphthalene (1,3,6,8-THN) reductase gene in the melanin biosynthesis pathway of B. oryzae. The expression of T4HR1 transcripts was enhanced by near-ultraviolet irradiation and regulated by the transcriptional factor BMR1, similar to three other melanin biosynthesis genes, suggesting that common transcriptional mechanisms could regulate the enhanced gene expression of these melanin biosynthesis genes by NUV irradiation in B. oryzae. The remaining melanin biosynthesis-related genes, such as an oxidase gene presumably involved in the oxidative polymerization of DHN, should be identified and characterized in order to completely elucidate the melanin biosynthesis pathway of B. oryzae. Studies of the transcriptional regulation of melanin biosynthesis genes by NUV irradiation could contribute to the elucidation of the molecular basis of the photomorphogenesis by NUV irradiation in B. oryzae.
Acknowledgements
This work was supported by JSPS KAKENHI Grants#22780067 and #25450101.
NOTESReferencesBell, A.A. and Wheeler, M.H. (1986) Biosynthesis and Functions of Fungal Melanins. Annual Review of Phytopathology, 24, 411-451. http://dx.doi.org/10.1146/annurev.py.24.090186.002211Butler, M.J. and Day, A.W. (1998) Fungal Melanins: A Review. Canadian Journal of Microbiology, 44, 1115-1136.http://dx.doi.org/10.1139/w98-119Henson, J.M., Butler, M.J. and Day, A.W. (1999) The Dark Side of the Mycelium: Melanins of Phytopathogenic Fungi. Annual Review of Phytopathology, 37, 447-471. http://dx.doi.org/10.1146/annurev.phyto.37.1.447Wang, Y. and Casadevall, A. (1994) Decreased Susceptibility of Melanized Cryptococcus neoformans to UV Light. Applied and Environmental Microbiology, 60, 3864-3866. http://www.ncbi.nlm.nih.gov/pubmed/7986054Rehnstrom, A.L. and Free, S.J. (1996) The Isolation and Characterization of Melanin-Deficient Mutants of Monilinia fructicola. Physiological and Molecular Plant Pathology, 49, 321-330. http://dx.doi.org/10.1006/pmpp.1996.0057Kawamura, C., Tsujimoto, T. and Tsuge T (1999) Targeted Disruption of a Melanin Biosynthesis Gene Affects Conidial Development and UV Tolerance in the Japanese Pear Pathotype of Alternaria alternata. Molecular Plant-Microbe Interactions, 12, 59-63. http://dx.doi.org/10.1094/MPMI.1999.12.1.59Gao, Q.J. and Garcia-Pichel, F. (2011) Microbial Ultraviolet Sunscreens. Nature Reviews Microbiology, 9, 791-802.http://dx.doi.org/10.1038/nrmicro2649Purschwits, J., Müller, S., Kastner, C. and Fischer, R. (2006) Seeing the Rainbow: Light Sensing in Fungi. Current Opinion in Microbiology, 9, 566-571. http://dx.doi.org/10.1016/j.mib.2006.10.011Herrera-Estrella, A. and Horwitz, B.A. (2007) Looking through the Eyes of Fungi: Molecular Genetics of Photoreception. Molecular Microbiology, 64, 5-15. http://dx.doi.org/10.1111/j.1365-2958.2007.05632.xCorrochano, L.M. (2007) Fungal Photoreceptors: Sensory Molecules for Fungal Development and Behaviour. Photochemical & Photobiological Sciences, 6, 725-736. http://dx.doi.org/10.1039/b702155kIdnurm, A., Vernma, S. and Corrochano, L.M. (2010) A Glimpse into the Basis of Vision in the Kingdom Mycota. Fungal Genetics and Biology, 47, 881-892. http://dx.doi.org/10.1016/j.fgb.2010.04.009Rodriguez-Romero, J., Hedtke, M., Kastner, C., Müller, S. and Fischer, R. (2010) Fungi, Hidden in Soil or Up in the Air: Light Makes a Difference. Annual Review of Microbiology, 64, 585-610. http://dx.doi.org/10.1146/annurev.micro.112408.134000Kubo, Y., Tsuda, M., Furusawa, I. and Shishiyama, J. (1989) Genetic Analysis of Genes Involved in Melanin Biosynthesis of Cochliobolus miyabeanus. Experimental Mycology, 13, 77-84. http://dx.doi.org/10.1016/0147-5975(89)90010-8Tajima, S., Kubo, Y., Furusawa, I. and Shishiyama, J. (1989) Purification of a Melanin Biosynthetic Enzyme Converting Scytalone to 1,3,8-trihydroxynaphthalene from Cochliobolus miyabeanus. Experimental Mycology, 13, 69-76. http://dx.doi.org/10.1016/0147-5975(89)90009-1Leach, C.M. (1961) The Sporulation of Helminthosporium oryzae as Affected by Exposure to Near Ultraviolet Radiation and Dark Periods. Canadian Journal of Botany, 39, 705-715. http://dx.doi.org/10.1139/b61-057Kumagai, T. (1983) Action Spectra for the Blue and Near-Ultraviolet Reversible Photoreaction in the Induction of Fungal Conidiation. Physiologia Plantarum, 57, 468-471. http://dx.doi.org/10.1111/j.1399-3054.1983.tb02770.xMoriwaki, A., Kihara, J., Kobayashi, T., Tokunaga, T., Arase, S. and Honda, Y. (2004) Insertional Mutagenesis and Characterization of a Polyketide Synthase Gene (PKS1) Required for Melanin Biosynthesis in Bipolaris oryzae. FEMS Microbiology Letters, 238, 1-8. http://dx.doi.org/10.1111/j.1574-6968.2004.tb09729.xKihara, J., Moriwaki, A., Ueno, M., Tokunaga, T., Arase, S. and Honda, Y. (2004) Cloning, Functional Analysis and Expression of a Scytalone Dehydratase Gene (SCD1) Involved in Melanin Biosynthesis of the Phytopathogenic Fungus Bipolaris oryzae. Current Genetics, 45, 197-204. http://dx.doi.org/10.1007/s00294-003-0477-1Kihara, J., Moriwaki, A., Ito, M., Arase, S. and Honda, Y. (2004) Expression of THR1, a 1,3,8-Trihydroxynaphthalene Reductase Gene Involved in Melanin Biosynthesis in the Phytopathogenic Fungus Bipolaris oryzae, Is Enhanced by Near-Ultraviolet Radiation. Pigment Cell Research, 17, 15-23. http://dx.doi.org/10.1046/j.1600-0749.2003.00102.xVidal-Cros, A., Viviani, F., Labesse, G., Boccara, M. and Gaudry, M. (1994) Polyhydroxynaphthalene Reductase Involved in Melanin Biosynthesis in Magnaporthe grisea. Purification, cDNA Cloning and Sequencing. European Journal of Biochemistry, 219, 985-992. http://dx.doi.org/10.1111/j.1432-1033.1994.tb18581.xThompson, J.E., Fahnestock, S., Farrall, L., Liao, D., Valent, B. and Jordan, D.B. (2000) The Second Naphthol Reductase of Fungal Melanin Biosynthesis in Magnaporthe grisea. Journal of Biological Chemistry, 275, 34867-34872. http://dx.doi.org/10.1074/jbc.M006659200Tsuji, G., Sugahara, T., Fujii, I., Mori, Y., Ebizuka, Y., Shiraishi, T. and Kubo, Y. (2003) Evidence for Involvement of Two Naphthol Reductases in the First Reduction Step of Melanin Biosynthesis Pathway of Colletotrichum lagenarium. Mycological Research, 107, 854-860. http://dx.doi.org/10.1017/S0953756203008001Engh, I., Nowrousian, M. and Kück, U. (2007) Regulation of Melanin Biosynthesis via the Dihydroxynaphthalene Pathway Is Dependent on Sexual Development in the Ascomycete Sordaria macrospora. FEMS Microbiology Letters, 275, 62-70. http://dx.doi.org/10.1111/j.1574-6968.2007.00867.xEliahu, N., Igbaria, A., Rose, M.S., Horwitz, B.A. and Lev, S. (2007) Melanin Biosynthesis in the Maize Pathogen Cochliobolus heterostrophus Depends on Two Mitogen-Activated Protein Kinases, Chk1 and Mps1, and the Transcription Factor Cmr1. Eukaryotic Cell, 6, 421-429. http://dx.doi.org/10.1128/EC.00264-06Kihara, J., Sato, A., Okajima, S. and Kumagai, T. (2001) Molecular Cloning, Sequence Analysis and Expression of Novel Gene Induced by Near-UV Light in Bipolaris oryzae. Molecular Genetics and Genomics, 266, 64-71. http://dx.doi.org/10.1007/s004380100519Kihara, J., Moriwaki, A., Matsuo, N., Arase, S. and Honda, Y. (2004) Cloning, Functional Characterization, and Near-Ultraviolet Radiation-Enhanced Expression of a Photolyase Gene (PHR1) from the Phytopathogenic Fungus Bipolaris oryzae. Current Genetics, 46, 37-46. http://dx.doi.org/10.1007/s00294-004-0507-7Kihara, J., Tanaka, N., Ueno, M. and Arase, S. (2014) Identification and Expression Analysis of Regulatory Genes Induced by Near-Ultraviolet Irradiation in Bipolaris oryzae. Advances in Microbiology, 4, 233-241. http://dx.doi.org/10.4236/aim.2014.45030Kihara, J., Moriwaki, A., Tanaka, N., Tanaka, C., Ueno, M. and Arase, S. (2008) Characterization of the BMR1 Gene Encoding a Transcriptional Factor for Melanin Biosynthesis Genes in the Phytopathogenic Fungus Bipolaris oryzae. FEMS Microbiology Letters, 281, 221-227. http://dx.doi.org/10.1111/j.1574-6968.2008.01101.xDavidson, R.C., Blankenship, J.R., Kraus, P.R., de Jesus Berrios, M., Hull, C.M., D’Souza, C., Wang, P. and Heitman, J. (2002) A PCR-Based Strategy to Generate Integrative Targeting Alleles with Large Regions of Homology. Microbiology, 148, 2607-2615. http://www.ncbi.nlm.nih.gov/pubmed/12177355Yu, J.H., Hamari, Z., Han, K.H., Seo, J.A., Reyes-Dominguez, Y. and Scazzocchio, C. (2004) Double-Joint PCR: A PCR-Based Molecular Tool for Gene Manipulations in Filamentous Fungi. Fungal Genetics and Biology, 41, 973-981. http://dx.doi.org/10.1016/j.fgb.2004.08.001Nayak, T., Szewczyk, E., Oakley, C.E., Osmani, A., Ukil, L., Murray, S.L., Hynes, M.J., Osmani, S.A. and Oakley, B.R. (2006) A Versatile and Efficient Gene-Targeting System for Aspergillus nidulans. Genetics, 172, 1557-1566. http://dx.doi.org/10.1534/genetics.105.052563Kimura, N. and Tsuge, T. (1993) Gene Cluster Involved in Melanin Biosynthesis of the Filamentous Fungus Alternaria alternate. Journal of Bacteriology, 175, 4427-4435. http://www.ncbi.nlm.nih.gov/pubmed/8392512Verwoerd, T.C., Dekker, B.M.M. and Hoekema, A. (1989) A Small-Scale Procedure for the Rapid Isolation of Plant RNAs. Nucleic Acids Research, 17, 2362. http://dx.doi.org/10.1093/nar/17.6.2362Kihara, J., Moriwaki, A., Tanaka, N., Ueno, M. and Arase, S. (2007) Characterization of the BLR1 Gene Encoding a Putative Blue-Light Regulator in the Phytopathogenic Fungus Bipolaris oryzae. FEMS Microbiology Letters, 266, 110-118.http://dx.doi.org/10.1111/j.1574-6968.2006.00514.x