The objectives of this study were to construct a database of expressed sequence tag (EST)-simple sequence repeat (SSR) markers to identify lettuce cultivars. A set of 370 EST-SSR primer pairs were applied for fingerprinting the lettuce cultivars. Fifty-eight EST-SSR markers showed hy-per-variability and were able to differentiate 92 cultivars. A total of 176 polymorphic amplified fragments were obtained by the 58 markers, and two to eight SSR alleles were detected for each l°Cus with an average of three alleles per locus. Average polymorphism information content (PIC) was 0.425, ranging from 0.022 to 0.743. Cluster analysis was based on Jaccard’s distance coefficients using the method of unweighted pair group. In this method we used arithmetical averages (UPGMA) algorithm categorized 4 major groups, which were in accordance to morphological traits. The eight cultivars of three groups with 100% genetic similarity through SSR analysis were investigated by phenotypic traits. These cultivars including these pairs are very similar in 27 morphological characteristics. Therefore, these EST-SSR markers could be used to select similar cultivars through management of reference collection to complement distinctiveness test of lettuce cultivars.
Lettuce (Lactuca sativa L., Asteraceae) is one of the most widely cultivated vegetables [
DNA markers have many advantages to identify cultivars due to their independence from environmental influences. The UPOV suggests that simple sequence repeat (SSR) markers are suitable for a DNA profiling database due to their multi-allelic nature, reproducibility, high polymorphism, easy automation, and co-dominant inheritance [
92 commercial lettuce cultivars were used in this study (
A total of 81,330 ESTs were downloaded from NCBI (to July 1, 2011) and assembled with CAP3 [
The 370 SSR primers were used to identify lettuce cultivars. PCR amplifications were performed in 25 µL volume containing 20 ng template DNA, 10 pmol∙µL−1 forward and reverse primers, 2.5 mM dNTP mixture, 10× PCR buffer solution, and 1 unit Taq polymerase (Genet Bio, Seoul, Korea). All primer combinations consisted of a 4 min initial denaturation at 94˚C followed by 40 PCR cycles of 30 s at 94˚C, 30 s at 55˚C, 45 s at 72˚C, and a final 10 min extension at 72˚C on T professionalTM thermocycler (Biometra, Göttingen, Germany). To select informative SSR markers, seven cultivars (“Gangpungjeokchima”, “Numberone”, “Icered”, “Eboniblack”, “Topgreen”, “Chirivel”, and “Ace”) among the 92 cultivars were first screened to select polymorphic SSR markers. The PCR products of the seven cultivars were separated on denatured 6% polyacrylamide gels and then silver stained with the DNA Silver Staining Kit (Promega Cat. Q4132, Madison, WI, USA) according to the manufacturer’s instructions. From the genotyping result of the seven lettuce cultivars, SSR primer pairs with
No. | Cultivars | Horticultural type | No. | Cultivars | Horticultural type |
---|---|---|---|---|---|
1 | Joara | Leaf (red) | 47 | Asiaoraettajeokchima | Leaf (red) |
2 | Hotred | Leaf (red) | 48 | Jingangjeokchungmyeon | Leaf (red) |
3 | Daepungjeokchima | Leaf (red) | 49 | Chamjinhanjeokchungmyeon | Leaf (red) |
4 | Hongssam | Leaf (red) | 50 | Pungbuheukchungmyeon | Leaf (red) |
5 | Myungpumtojongjeokchukmyeon | Leaf (red) | 51 | Evergreen | Leaf (green) |
6 | Jeoksamgakchae | Leaf (red) | 52 | Ongreen | Leaf (green) |
7 | Onpungjeokchima | Leaf (red) | 53 | Cheongpungchima | Leaf (green) |
8 | Operajeokchukmyeon | Leaf (red) | 54 | Cheongpungyeoreumchima | Leaf (green) |
9 | Mipungpochabjeokchukmyeon | Leaf (red) | 55 | Yeoreumgaeryangdambae | Leaf (green) |
10 | Hongpungchima | Leaf (red) | 56 | Greencheongchima | Leaf (green) |
11 | Jangpungyeoreumchima | Leaf (red) | 57 | Sanggreen | Leaf (green) |
12 | Taepungyeoreumjeokchukmyeon | Leaf (red) | 58 | Topgreen | Leaf (green) |
13 | Hapungjeokpogi | Leaf (red) | 59 | Jeilsangchae | Leaf (green) |
14 | Jinsunhongjeokchukmyeon | Leaf (red) | 60 | Jeilcheongchukmyeon | Leaf (green) |
15 | Asiajinppalchima | Leaf (red) | 61 | Garyangdambaesangchu | Leaf (green) |
16 | Jeoksamgakchu | Leaf (red) | 62 | Hanbiccheongchima | Leaf (green) |
17 | Sunmangjeokchukmyeon | Leaf (red) | 63 | Greenglace | Leaf (green) |
18 | Chamjon | Leaf (red) | 64 | Scanstar | Leaf (green) |
19 | Yeonsanhongjeokchukmyeon | Leaf (red) | 65 | Snowgreen | Leaf (green) |
20 | Honghwajeokchukmyeon | Leaf (red) | 66 | Hanbatcheongchima | Leaf (green) |
21 | Dabaljeokchukmyeon | Leaf (red) | 67 | Sambokmeokchima | Leaf (black) |
22 | Yeoreumchammakjeokchima | Leaf (red) | 68 | Meokchima | Leaf (black) |
23 | Mujeokyeoreumjeokchima | Leaf (red) | 69 | Heukssammeokchima | Leaf (black) |
24 | Manhongpochab | Leaf (red) | 70 | Sunjoheukchima | Leaf (black) |
25 | Jinpungjeokchukmyeon | Leaf (red) | 71 | Mujeokyeoreumheukchima | Leaf (black) |
26 | Hartjeokchima | Leaf (red) | 72 | Meokdoli | Leaf (black) |
27 | Redstar | Leaf (red) | 73 | Eboniblack | Leaf (black) |
28 | Manchuredstar | Leaf (red) | 74 | Heukssamchima | Leaf (black) |
29 | Ttuksumcheongchukmyeon | Leaf (red) | 75 | Peoseutgyeolgu | Crisphead |
30 | Yeolgangjeokchima | Leaf (red) | 76 | Beseutgyeolgu | Crisphead |
31 | Rosequeenjeokchukmyeon | Leaf (red) | 77 | Wintergreen | Crisphead |
32 | Rubella | Leaf (red) | 78 | Buttikkeu | Crisphead |
33 | Rubella2ho | Leaf (red) | 79 | Eurake | Crisphead |
34 | Danpungjeokchima | Leaf (red) | 80 | Pungseong | Crisphead |
35 | Gangpungjeokchima | Leaf (red) | 81 | Adam | Crisphead |
36 | Numberone | Leaf (red) | 82 | Sensation | Crisphead |
37 | Icered | Leaf (red) | 83 | Chirivel | Crisphead |
38 | Jeokdan | Leaf (red) | 84 | Yeoreumgohyangdambae | Romaine |
39 | Sunpungpochabjeokchukmyeon | Leaf (red) | 85 | Cheonpung | Romaine |
40 | Ace | Leaf (red) | 86 | Sanggeurangssam | Romaine |
41 | Misunjeokchukmyeon | Leaf (red) | 87 | Sijeoseugreen | Romaine |
42 | Hwahongjeokchukmyeon | Leaf (red) | 88 | Mansang | Romaine |
43 | Redsunjeokchukmyeon | Leaf (red) | 89 | Cheonsang | Romaine |
44 | Pochabijeokchukmyeon | Leaf (red) | 90 | Starromaine | Romaine |
45 | Jeokchima | Leaf (red) | 91 | Sunnyredbutter | Butterhead |
46 | Sunhongjeokchukmyeon | Leaf (red) | 92 | Sunredbutter | Butterhead |
highly reproducible and clear band patterns were respectively labeled at the end site of the forward primer with FAM, VIC, NED, and PET dye and then PCR amplification was performed. The PCR products (4 µL) were separated on 2% agarose gels and then 1 - 3 µL was mixed with 200 µL water depending on the intensity of the PCR products. 1.5 µL aliquot of diluted PCR product, 10 µL of deionized formamide and 0.25 µL of size marker (LIZ500 size standard) were mixed and denatured for 5 min at 94˚C. The PCR products of 94 cultivars were analyzed by capillary electrophoresis (Genetic Analyzer 3130XL, Applied Biosystems, Foster City, CA, USA) using the manufacturer’s instructions. The allele determination for the SSR markers was evaluated with the GeneMapper 3.7 software program (Applied Biosystems).
Peaks were scored with regard to the presence and absence of peaks for genotypes. Scores of “1” and “0” designated the presence and absence of peaks for each SSR marker allele, respectively. Polymorphism information content (PIC) was calculated via the formula established by [
where Pij is the frequency of the jth allele for the ith locus summed across all alleles for the locus. The cluster analysis was based on Jaccard’s similarity coefficient using the unweighted pair group method using arithmetical averages [
Morphological characters were analyzed according to the DUS characteristics of the lettuce test guideline prescribed by the Korea Seed & Variety Service (http://www.seed.go.kr). 29 were used among 39 morphological characters of lettuce for the DUS test.
With 81,330 lettuce ESTs from the NCBI database, 41,609 singletons and 8452 contigs were identified by CAP3 software. In total, 4229 SSR loci from singletons [
The 348 SSR primers developed previously [
Several reports have described PIC value of SSR analysis in lettuce. This result was higher than 0.32 reported by [
Number of screened markers | Type of SSR makers | Polymorphism (%) of amplified SSR markers | SSR marker source |
---|---|---|---|
20 | EST-SSR of lettuce (L. sativa L.) | 1/20 (5%) | Jeuken et al. (2008) |
61 | EST-SSR of lettuce (L. sativa L.) | 30/61 (49.2%) | Simko (2009) |
267 | EST-SSR of lettuce (L. sativa L.) singletons | 47/267 (17.6%) | Hong et al. (2013) |
22 | EST-SSR of lettuce (L. sativa L.) contigs | 4/22 (18.2%) | Hong et al. (2013) and in this study |
Total 370 | 82/370 (22.2%) |
No. | Primer name | EST/Contig ID | Repeat motif | Primer sequence (5'-3') | Ta (˚C) | Product sizes | No. of alleles | PIC | |
---|---|---|---|---|---|---|---|---|---|
1 | SML-001 | QGC15N13 | (CATGAT)6 | F: CCATGGATCCTGTGTGAAGA | R: CACCATGTTCCACTTCCACTT | 55 | 176 - 198 | 4 | 0.581 |
2 | SML-002 | QGH4c05 | (TTC)17 | F: GTGATTGCATGCCAAATGAA | R: TTAGTAGCCCGCATGCTTTT | 55 | 204 - 225 | 4 | 0.310 |
3 | SML-003 | QGA14A20 | (GTTTT)5 | F: CGGGCTGGTTTTGATTTTTA | R: TGTCAAATCGTCACGTGGTT | 55 | 114 - 119 | 2 | 0.418 |
4 | SML-007 | QGG10L02 | (TCACCA)19 | F: ACACTTGCCGATTCCTTCAC | R: ACCCGTGTTGAAAATGGAGA | 55 | 184 - 202 | 3 | 0.519 |
5 | SML-013 | Cntg-4755 | (GAA)14…(CTG)5 | F: TCCCATGATGGAGAGACTCA | R: CCCAAAAGGGAATAGCAACC | 55 | 265 - 276 | 3 | 0.434 |
6 | SML-015 | Cntg-1438 | (TGTTA)16 | F: TTGAGGAGGGCATTTACGTC | R: GAGGCGTATCTCCAAGGTGT | 55 | 254 - 269 | 3 | 0.471 |
7 | SML-019 | Cntg-1238 | (ATATG)5 | F: AAGGAGGAAAGTATGGTGAGGA | R: TGAAATGAAGCAACACACGA | 55 | 163 - 168 | 2 | 0.375 |
8 | SML-020 | Cntg-419 | (AATG)6 | F: GTGGTCGTGATGATGCTTTG | R: TGCAATCCCTCTTTTCTTCAA | 55 | 223 - 227 | 2 | 0.141 |
9 | SML-038 | Cntg-4846 | (CCA)4 | F: ACCTCCTCCGTCACCAAGT | R: TCGCAAATTTTCTTGCCTTT | 55 | 189 - 192 | 2 | 0.291 |
10 | SML-039 | Cntg-5632 | (CCCCTT)2 | F: ATTACCCCTGGCCTTATGCT | R: TCGTATCTTGGCTGCTCCAT | 55 | 229 - 235 | 2 | 0.444 |
11 | SML-042 | Cntg-6454 | (CGGA)2 (AGGA)3 AAG (A)11* (GAAAGA)2 | F: CATGAAGTGTTTTGGGGTGA | R: GGCCTTTCATTTCTTCCTCA | 55 | 189 - 193 | 3 | 0.435 |
12 | SML-043 | Cntg-649 | (T)14 | F: TTCTTTCGCCCATCTGAAAC | R: AAACAGGGGGCTAACGATCT | 55 | 192 - 198 | 3 | 0.468 |
13 | SML-045 | Cntg-7478 | (AAG)9 | F: ACAAAACCGTTTCACCCAAA | R: AGCCCTGTCCTCTTCAGGAT | 55 | 220 - 226 | 3 | 0.375 |
14 | SML-048 | Cntg-7935 | (T)12 | F: TTTGAGGCAGGTGTTAGCTG | R: GAACAAAGTTACAACGAGAGGAAA | 55 | 114 - 123 | 3 | 0.337 |
15 | SML-051 | QGC13L24 | (TAA)8 | F: CTCAAGGCGGCATCTACTTC | R: GACCCCTTGCTTGTTTCAGA | 55 | 237 - 240 | 2 | 0.315 |
16 | SML-052 | Cntg-2202 | (CAT)5 | F: CTGTAGCCGGGAATTGAAGT | R: TGCCCCTAAACAAGACCTACA | 55 | 219 - 228 | 2 | 0.022 |
17 | SML-054 | Cntg-3649 | (TA)3 | F: CCATGCCATGCAGTATACCTT | R: AAAAATGACTGCATACTTTGTGAA | 55 | 269 - 271 | 3 | 0.529 |
18 | SML-055 | Cntg-3666 | (TGA)15…(ATG)9 | F: CTGCGTGTTTTAAGCCGTTT | R: TCCATAATAATATAATCGCACCAA | 55 | 224 - 239 | 2 | 0.378 |
19 | SML-056 | QGE4h11 | (TTA)14 | F: GCCTAGTCCAATTGCTTTGC | R: CAGCTTAACATACTTTTGTTCATTCA | 55 | 183 - 189 | 2 | 0.350 |
20 | SML-057 | QGB14L18 | (GAA)14…(CTG)5 | F: TCCCATGATGGAGAGACTCA | R: CCCAAAAGGGAATAGCAACC | 55 | 266 - 278 | 3 | 0.437 |
21 | SML-059 | Cntg-4454 | (TCT)12 | F: GATAAAGGCTGGACCGATGA | R: GTTTGGTTTGGTTTGGCAAG | 55 | 177 - 208 | 3 | 0.536 |
22 | SML-061 | Cntg-3414 | (AACA)6 | F: GAGTGCTGAGAAAGCCCAAG | R: TAAGCTGCTCTTCCCTCCTG | 55 | 203 - 207 | 2 | 0.402 |
23 | SML-021 | Cntg-1077 | (TA)8 | F: TTGGGAGAATTTTCATTTCCA | R: AGTCATCTTTTTCACCCCACA | 55 | 172 - 180 | 4 | 0.521 |
24 | SML-022 | Cntg-1211 | (ATC)13 | F: GGGCCTCAAATCCTCTCTG | R: TGTTCTTCCCCTCTTTGGAA | 55 | 314 - 338 | 4 | 0.511 |
25 | SML-026 | Cntg-2481 | (GAA)11 | F: GGGTTCTCATTGGCTGACAT | R: TGTCTTCCAACCAAAACATACA | 55 | 172 - 198 | 3 | 0.500 |
26 | SML-028 | Cntg-2789 | (A)15 | F: TGATCCAGGCTCTCCAGAAT | R: CACGACCATGAATGATAAGTGC | 55 | 170 - 181 | 3 | 0.511 |
27 | SML-032 | Cntg-3460 | (T)4 | F: TTGGATTTGGGGTGATGAAT | R: GCATAGTAATTTGACATTTTGGCATA | 55 | 215 - 216 | 2 | 0.465 |
28 | SML-036 | Cntg-4454 | (TCT)12… (CCAAA)4 | F: CTGCTGCTGTTTTGCTCTTG | R: CCTGAGGTGAGGTTGTCAAT | 55 | 214 - 217 | 2 | 0.137 |
29 | SML-037 | Cntg-4499 | (AAC)3 | F: TTTTTCCCGATCTTTGCATC | R: AGCGAATCTTTGCTTTTTCG | 55 | 211 - 214 | 2 | 0.282 |
No. | Primer name | EST/Contig ID | Repeat motif | Primer sequence (5'-3') | Ta (˚C) | Product size | No. of alleles | PIC | |
---|---|---|---|---|---|---|---|---|---|
30 | KSL-1 | CLSS10849 | (CAA)10 | F: CACCACTCCATTTCATCCCA | R: GCTCATTCCCAAACCCAGAT | 55 | 162 - 171 | 3 | 0.197 |
31 | KSL-37 | CLSM1424 | (AGA)15 | F: TCTCTTGCTCCAATACCCGA | R: GTATCGGGCTCATGTCCCTT | 55 | 125 - 155 | 6 | 0.666 |
32 | KSL-51 | CLSZ1624 | (ATG)10 | F: CCCCTACCACCACCAAAGTC | R: TACCAAATGACATGCACCCC | 55 | 184 - 205 | 4 | 0.461 |
33 | KSL-271 | CLSS8197 | (ATG)12 | F: ACAAAGGCAAGATTGGGTCA | R: GCGGATATGCAGCCATAACA | 55 | 238 - 250 | 3 | 0.505 |
34 | KSL-316 | QGC8F02 | (AAT)11 | F: CGCAGCCTTCAAAACTACCA | R: AGCAACTGAAATCCAACCCC | 55 | 272 - 281 | 2 | 0.461 |
35 | KSL-317 | QGC8E09 | (ATG)11 | F: TGTGGATCTGAATGGGCATC | R: TGCAAGAATGTTGGCTTCCT | 55 | 248 - 251 | 2 | 0.496 |
36 | KSL-357 | CLSS10992 | (TGA)14 | F: GCAGCAACAAGAAACCCAAA | R: GCCCCAACATCATCATCATC | 55 | 255 - 283 | 2 | 0.356 |
37 | KSL-87 | CLSY5704 | (CT)17 | F: GCGGGATCGATACTTACCCT | R: ATCATCGACGGGCTTTTCTT | 55 | 256 - 272 | 7 | 0.614 |
38 | KSL-173 | CLSM444 | (CT)14 | F: ATAGTCACGACTCACGCCCA | R: CCATTTTCCTCTTTCTGCGA | 55 | 155 - 165 | 4 | 0.608 |
39 | KSL-245 | CLSM513 | (AG)16 | F: CTTCACCTCCGGAATCCTGT | R: GAGGCACGACTGCCATTTAG | 55 | 269 - 283 | 4 | 0.138 |
40 | KSLC-4 | A35 | (GGT)5 | F: TGGGGGAACATCACAAACAC | R: ACTTCCGACCACCAATAGGG | 55 | 196 - 199 | 2 | 0.328 |
41 | KSLC-30 | B14 | (CA)6 | F: GGGGCCTCTATCCACTCTCA | R: AAAGTCCAGCCATCTCTGCC | 55 | 162 - 164 | 2 | 0.437 |
42 | KSLC-322 | L146 | (TTATA)4 | F: CTCCTCCGGGAAACTATGGA | R: TCTCCAACACAACACCCACC | 55 | 290 - 300 | 3 | 0.349 |
43 | KSLC-443 | R439 | (GAAGAG)4 | F: GACGATGACGACGTGGAAAG | R: CCTCCAGCTGCAAACCAGTA | 55 | 262 - 271 | 2 | 0.063 |
44 | KSL-7 | CLSS10499 | (TCT)12 | F: TGCTCAATCTCGAGCTTATCCT | R: ATGTGCCCACAAGGAAGACA | 55 | 378 - 396 | 3 | 0.505 |
45 | KSL-26 | CLSM14994 | (TC)16 | F: GGGCTTTCTCTCCTTTCCTTT | R: AATTTGGATCCTGTCGAGGG | 55 | 300 - 319 | 8 | 0.743 |
46 | KSL-32 | CLSM14764 | (CT)14 | F: CGGGGAGCATTTAGTGTGTG | R: AATTTGGGGTCCGATTTGAG | 55 | 210 - 218 | 5 | 0.610 |
47 | KSL-43 | CLSM1373 | (ATC)9(TTC)8 | F: GACGCAAACCTTTACCAGCA | R: TCATTCCATTCCATTGGGTG | 55 | 269 - 281 | 3 | 0.501 |
48 | KSL-44 | CLSM13555 | (TCACCA)4tcat (CATCAC)5catcg (CCATCA)5 | F: CGATTCCTTCACCTCCACCT | R: CTGTCAATCGTGCCAGTTCC | 55 | 229 - 246 | 3 | 0.510 |
49 | KSL-75 | CLSY7906 | (TC)6tt(TC)6 | F: AGAGGCTTTCTACGCCAACC | R: TGAGGAGGGGGAAGTTCATC | 55 | 205 - 207 | 2 | 0.444 |
50 | KSL-83 | CLSY6646 | (AG)6tgtgt(GA) 7aa(GT)6 | F: GCGGAGCTTCTTTCTCACCT | R: GGAAAGAAAACGCATTTCGAG | 55 | 249 - 287 | 2 | 0.315 |
51 | KSL-92 | CLSY517 | (CT)20 | F: GGTCTCTTTCCTCTGCCCTG | R: TCGCGTTCTGAAGTAGCCAT | 55 | 188 - 196 | 5 | 0.735 |
52 | KSL-97 | CLSY4815 | (CT)11 | F: CGCAGAAAAGGGATCAGACA | R: TCAGAGACACTGCAAAAGGGA | 55 | 223 - 232 | 3 | 0.616 |
53 | KSL-102 | CLSY4549 | (TGA)5tgt(TGA)6 | F: AAGCCCCAATGACGAATCTC | R: TGTCAATAGCAATGGCGAAA | 55 | 313 - 320 | 3 | 0.121 |
54 | KSL-115 | CLSM11208 | (CT)11 | F: CATTGCACTCCGTCATCTCC | R: GGGTTGATTCCGAAAGTTCC | 55 | 210 - 212 | 2 | 0.477 |
55 | KSL-119 | CLSM10279 | (TC)16 | F: TTCGACTCGTCTTCGACGC | R: CGATGTCACACCACCCATCT | 55 | 271 - 279 | 4 | 0.642 |
56 | KSL-123 | CLSL2393 | (ATC)13 | F: ATTGTAACTTCTGCGGGCCT | R: GCCTCACATGTTCTTCCCCT | 55 | 336 - 360 | 4 | 0.511 |
57 | KSL-137 | CLSZ3622 | (TGA)9caatgatgaaaaagatgatgcagaggaggcagatgatgatgctggagatgaagatttctcaggagaagaagggggagag(GAT)6gaagaagaccctagtgaagatcctaaggcaaatggtaatcaagacgac(GAT)7gacgacgac(GAT)6 | F: TTCTCTGAGCTTCACAAGAGGG | R: TCATCACCATCATCATTTCCC | 55 | 281 - 298 | 4 | 0.666 |
58 | KSL-152 | CLSM12854 | (GAC)5gatgagc (AAG)8 | F: CGAGGTCGAAGAAGAGGAGG | R: TCCCATTAGGATCTCTGCCC | 55 | 268 - 284 | 2 | 0.063 |
Total | 176 | 24.63 | |||||||
Mean | 3.03 | 0.425+ |
markers was lower than that for the genomic SSR markers. The reason might be that EST-SSR markers are based on the translated region [
A dendrogram based on the similarity coefficients of the 92 cultivars was constructed. The dendrogram scale varied from 0.29 to 1.00 (
Cluster II consisted of cultivars with Crisphead, Romaine, Green leaf, and Butterhead, which split into two clusters with a mean similarity of 0.43. Cluster II-1 consisted of cultivars with Crisphead, Romaine, Green leaf, and cluster II-2 cultivars with consisted of the Butterhead type. Crisphead was clustered in one group with a similarity level of 0.70. Cluster III consisted of cultivars with green leaf and black leaf at a similarity level of 0.47. Cluster III-1 contained cultivars with green leaf, and cluster III-2 contained black leaf except for “Cheongpungchima” and “Greencheongchima”. Cluster IV contained cultivars with the green leaf of “Greenglace” and “Scanstar”. Generally, the clustering of 92 lettuce cultivars was mainly categorized into 4 major groups corresponding to morphological traits. However, eight cultivars (Group 1: “Cheongpungchima” and “Greencheongchima”, Group 2: “Sambokmeokchima”, “Heukssammeokchima”, and “Meokdoli”, Group 3: “Yeoreumgohyangdambae”, “Cheonpung”, and “Sijeoseugreen”) were not discriminated by the 58 EST-SSR markers. These cultivars may be developed by parents with narrow genetic background, and a limited number of SSR markers were used to identify for lettuce cultivars.
We investigated morphological traits for 3 pairs with 100% genetic similarity. However, cultivars in each pairs were not distinct for the 29 morphological traits under same environmental condition (
Character code | Character description | Characteristics | Type of char. | Note | Group 1 | Group 2 | Group 3 | |||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
53 | 56 | 67 | 69 | 72 | 84 | 85 | 87 | |||||
1 | Seedling: anthocyanin coloration | Absent | QL | 1 | 1 | 1 | 9 | 9 | 9 | 1 | 1 | 1 |
Present | 9 | |||||||||||
2 | Seedling: size of cotyledon | Small | QN | 3 | 5 | 5 | 5 | 5 | 5 | 5 | 5 | 5 |
Medium | 5 | |||||||||||
Large | 7 | |||||||||||
3 | Seedling: shape of cotyledon | Narrow elliptic | QN | 3 | 5 | 5 | 5 | 5 | 5 | 5 | 5 | 5 |
Elliptic | 5 | |||||||||||
Broad elliptic | 7 | |||||||||||
4 | Leaf: attitude at 10 - 12 leaf stage | Erect | QN | 3 | 5 | 5 | 5 | 5 | 5 | 5 | 5 | 5 |
Semi-erect | 5 | |||||||||||
Prostrate | 7 | |||||||||||
5 | Leaf blade: division | Absent | QL | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 |
Present | 2 | |||||||||||
6 | Plant: diameter | Very small | QN | 1 | 7 | 7 | 5 | 5 | 5 | 7 | 7 | 7 |
Small | 3 | |||||||||||
Medium | 5 | |||||||||||
Large | 7 | |||||||||||
Very large | 9 | |||||||||||
7 | Plant: head formation | No head | PQ | 1 | 1 | 1 | 1 | 1 | 1 | 2 | 2 | 2 |
Semi heading | 2 | |||||||||||
Joined-up type | 3 | |||||||||||
Wrapped-overtype | 4 | |||||||||||
8 | Leaf: thickness | Thin | QN | 3 | 7 | 7 | 5 | 5 | 5 | 7 | 7 | 7 |
Medium | 5 | |||||||||||
Thick | 7 | |||||||||||
9 | Leaf: attitude at harvest maturity | Erect | QN | 3 | 5 | 5 | 5 | 5 | 5 | 5 | 5 | 5 |
Semi-erect | 5 | |||||||||||
Prostrate | 7 | |||||||||||
10 | Leaf: shape | Narrow elliptic | PQ | 1 | 2 | 2 | 2 | 2 | 2 | 2 | 2 | 2 |
Medium elliptic | 2 | |||||||||||
Broad elliptic | 3 | |||||||||||
Circular | 4 | |||||||||||
Transverse broad obtrullate | 5 | |||||||||||
Transverse narrow obtrullate | 6 | |||||||||||
Obovate | 7 | |||||||||||
Broad obtrullate | 8 | |||||||||||
Triangular | 9 | |||||||||||
11 | Leaf: color of outer leaves | Yellowish | PQ | 1 | 2 | 2 | 5 | 5 | 5 | 2 | 2 | 2 |
Green | 2 | |||||||||||
Greyish green | 3 | |||||||||||
Blueish green | 4 | |||||||||||
Reddish | 5 | |||||||||||
12 | Leaf: intensity of color of outer leaves | Very light | QN | 1 | 5 | 5 | 7 | 7 | 7 | 5 | 5 | 5 |
Light | 3 | |||||||||||
Medium | 5 | |||||||||||
Dark | 7 | |||||||||||
Very dark | 9 | |||||||||||
13 | Leaf: anthocyanin coloration | Absent | QL | 1 | 1 | 1 | 9 | 9 | 9 | 1 | 1 | 1 |
Present | 9 | |||||||||||
14 | Leaf: intensity of anthocyanin coloration | Very weak | QN | 1 | - | - | 7 | 7 | 7 | - | - | - |
Weak | 3 | |||||||||||
Medium | 5 | |||||||||||
Strong | 7 | |||||||||||
Very strong | 9 |
Character code | Character description | Characteristics | Type of char. | Note | Group 1 | Group 2 | Group 3 | |||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
53 | 56 | 67 | 69 | 72 | 84 | 85 | 87 | |||||
15 | Leaf: distribution of anthocyanin | Localised | QL | 1 | - | - | 2 | 2 | 2 | - | - | - |
Entire | 2 | |||||||||||
16 | Leaf: kind of anthocyanin distribution | Diffused only | QL | 1 | - | - | 1 | 1 | 1 | - | - | - |
In spots only | 2 | |||||||||||
Diffused and in spots | 3 | |||||||||||
17 | Leaf: glossiness of upper side | Absent or very weak | QN | 1 | 3 | 3 | 7 | 7 | 7 | 5 | 5 | 5 |
Weak | 3 | |||||||||||
Medium | 5 | |||||||||||
Strong | 7 | |||||||||||
Very strong | 9 | |||||||||||
18 | Leaf: surface profile of outer leaves | Concave | QN | 3 | 5 | 5 | 5 | 5 | 5 | 5 | 5 | 5 |
Flat | 5 | |||||||||||
Convex | 7 | |||||||||||
19 | Leaf: blistering | Absent or very weak | QN | 1 | 9 | 9 | 3 | 3 | 3 | 1 | 1 | 1 |
Weak | 3 | |||||||||||
Medium | 5 | |||||||||||
Strong | 7 | |||||||||||
Very strong | 9 | |||||||||||
20 | Leaf: size of blisters | Small | QN | 3 | 7 | 7 | 5 | 5 | 5 | 3 | 3 | 3 |
Medium | 5 | |||||||||||
Large | 7 | |||||||||||
21 | Leaf blade: degree of undulation of margin | Absent or very weak | QN | 1 | 5 | 5 | 5 | 5 | 5 | 1 | 1 | 1 |
Weak | 3 | |||||||||||
Medium | 5 | |||||||||||
Strong | 7 | |||||||||||
Very strong | 9 | |||||||||||
22 | Leaf blade: presence of incisions of margin on apical part | Absent | QL | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 |
Present | 9 | |||||||||||
23 | Leaf blade: depth of incisions of margin on apical part | Shallow | QN | 3 | - | - | - | - | - | - | - | - |
Medium | 5 | |||||||||||
Deep | 7 | |||||||||||
24 | Leaf blade: degree of incisions on margin on apical part | Sparse | QN | 3 | - | - | - | - | - | - | - | - |
Medium | 5 | |||||||||||
Dense | 7 | |||||||||||
25 | Leaf blade: venation | Not flabellate | QL | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 |
Flabellate | 2 | |||||||||||
26 | Axillary sprouting | Absent or very weak | QN | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 |
Weak | 3 | |||||||||||
Medium | 5 | |||||||||||
Strong | 7 | |||||||||||
Very strong | 9 | |||||||||||
27 | Bitter taste | Absent | QL | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 | 1 |
Present | 9 | |||||||||||
28 | Time of harvest maturity | Early | QN | 3 | 5 | 5 | 5 | 5 | 5 | 5 | 5 | 5 |
Medium | 5 | |||||||||||
Late | 7 | |||||||||||
29 | Time of beginning of bolting under long day conditions | Very early | QN | 1 | 7 | 7 | 7 | 7 | 7 | 7 | 7 | 7 |
Early | 3 | |||||||||||
Medium | 5 | |||||||||||
Late | 7 | |||||||||||
Very late | 9 |
QL: qualitative, QN: quantitative, PQ: pseudo-qualitative. The upper numbers refer to the list of cultivars in
addition, lettuce breeders were in agreement with our results of morphological traits. The correlation between molecular and morphological data for 8 cultivars in 3 pairs was analyzed by the [
UPOV established the possible use of molecular markers for a DUS test [