Raw264.7 cells are monocytic cells that can differentiate to activated macrophages after lipopoly-saccharide (LPS) stimulation. Here, we analyzed the factors secreted by Raw264.7 cells in response to LPS. The culture media of LPS-treated Raw264.7 cells was able to stimulate growth in MEF1F2 and NIH3T3 mouse fibroblast cell lines. We identified five secreted and LPS-induced chemokines, CCL2, CCL5, CCL12, CxCL2, and CxCL10, by microarray analysis and tested their stimulatory activity. We used commercially available bacterially expressed proteins, and found only CCL12, CxCL2 and CxCL10 stimulated growth in MEF1F2 and NIH3T3 cells. The saturation density of the cells was also increased. They were not able to stimulate growth in v-Src transformed MEF1F2 or SWAP-70 transformed NIH3T3 cells. We examined signaling pathways activated by these three factors. We found that ERK and p38 MAP kinase were activated and were required for the activity to stimulate the cell growth. Other pathways including phosophatidylinositol-3 kinase (PI3K), NFκB pathways were not activated. These results suggest that Raw264.7 cells secretes growth stimulation factors for fibroblasts when differentiated to macrophages implicating that fast growth of them is related to inflamation although the reason is still unclear.
Inflammation in vascular tissues is part of a complex biological response to harmful stimuli, such as pathogens, damaged cells, or irritants [
Chemokines are a family of small molecular weight cytokines, or signaling proteins secreted by cells [
CxCL10 is also a C-x-C motif chemokine with a molecular weight of 8.7 kDa in humans [
Raw264.7 monocytic cells differentiate to form activated macrophages, which are polarized toward that of the M2 macrophage phenotype, upon lipopolysaccharide (LPS) stimulation. Many studies have focused on the function of macrophages during inflammation, and PDGF, EGF, and some other factors have been shown to be secreted for growth of fibroblasts but there is still a room to be seen about other factors. Also during wound and healing, macrophages secrete growth factors [
Raw264.7 and NIH3T3 cells were purchased from the Food Industry Research and Development Institute, Taiwan. NIH3T3/SWAP-70-590 cells were transformed with SWAP-70 as described before [
To obtain culture supernatants of Raw264.7 cells, they were stimulated with 100 ng/ml LPS and cultured for 24 hrs. The culture supernatant was collected. For the control culture supernatant, cells were cultured for 24 hrs and LPS was added just after harvesting the culture supernatant.
To test activated Raw264.7 cells continuously secrete the growth stimulating factors, confluent Raw264.7 cells were incubated with or without 100 ng/ml LPS and after 24 hours the culture supernatant was harvested. Then, new medium without LPS was added to the culture, incubated for 24 hours, medium was changed again, incubated for another 24 hrs, and the culture medium was harvested.
Bacterially expressed chemokines, CCL2, CCL5, CCL12, CxCL2, and CxCL10 were purchased from R & D system (Minneapolis, MN, USA). Anti-ERK, anti-phospho ERK, p38 MAP kinase, anti-phospho p38 MAP kinase, Akt, anti-Phospho Akt, anti-IκB, and anti-phosphoIκB antibodies were purchased from Cell Signaling Co Ltd (Danvers, MA, USA). An ERK inhibitor, PD59089 and a p38 MAP kinase inhibitor, SB203580, were purchased from WAKO Co. Ltd (Tokyo, Japan).
RNA extraction was performed using RNA extraction kit (Zymo Research, Irvine, CA, U.S.A.). Reverse transcriptase reaction was performed using the PrimeScript (Takara, Tokyo, Japan). PCR was done using ExTaq polymerase (Takara). Presence of chemokine receptors was analyzed by PCR using the following primers: ATGGAGATTTCAGATTTCACAGAAG and TCAGAAGCCAGCAGAGAGCTCATGTTC (CCR1); ATG GAAGACAATAATATGTTACC and TCACTTACTTTACAACCCAACCG (CCR2); GGCATTCAACACAG ATGA AATCAAG and CTAAAACACCACAGAGATTTCTTGC (CCR3); ATGGATTTTCAAGGGTCAGT TCCG and TCATGTTCTCCTGTGGATCGGGTATAG (CCR5); CAAAGATGGGAGAATTCAAGGTGG and CTTTAGAGGGTAGTAGAGGTGT (CxCR2); and ATGTACCTTGAGGTTAGTGAACG and TTACAAGC CCAGGTAGGAGGCC (CxCR3).
Cells were harvested after stimulation of the chemokines. Cells were lysed with a buffer containing 10 mM Tris-HCl pH 7.5, 100 mM NaCl, 5 mM EDTA, 1 mM sodium vanadate, and 1 mM PMSF. Aliquots of the samples were loaded on the SDS-PAGE and Western blotting was done as described before [
Cells were plated at a density of 3 × 104 cells per dish in 3.5 cm dishes. To maintain growth factor activity, the media were changed every day. Number of cells in each dish were counted and expressed in graphs. To test effect of concentration of chemokines 1 × 105 cells were seeded and cultured for two days in the presence of various concentrations of chemokines.
RNA was prepared from confluent cultures of MEF1F2, MEF1F2-SWAP-1, and MEF1F2-SWAB-7 cells. For microarray analysis, oligoarray type array (Agilent SurePrint G3 Mouse GE 8 x 60K) was used. Total RNA (0.2 mg) was labeled with Cy3-CTP using Agilent low input quick-Amp labeling kit. Hybridization was done by Agilent one-color microarray-based gene expression analysis low input quick-amp labeling kit v6.5 using 0.6 µg of cRNA. Genes whose expression levels were increased two fold compared with control cells were selected with p-value cut off of 0.05.
Raw264.7 cells were stimulated with 100 ng/ml LPS and their culture medium was harvested after 24 h. Subsequently, SWAP-70(-) and NIH3T3 cells were incubated overnight with the harvested media. We found that this treatment led to growth stimulation in fibroblasts, but the effects were not sustained for longer than 24 h. We speculated that this was due to the potential instability of growth factors in the harvested medium. Indeed, daily replenishment of harvested media led to sustained growth stimulation of fibroblasts (
Secreted factors from LPS-treated Raw264.7 cells maintained their growth stimulatory activity for several days (
We tested the effect of CCL12, CxCL2 and CxCL10 on transformed MEF1F2 or NIH3T3 cells. The cells grown in the presence of these chemokines showed fast growth compared to the control cells, suggesting that they stimulate cell growth. However, they exhibited contact inhibition at the higher cell densities, suggesting that the cells are not transformed (
To confirm that MEF1F2 and NIH3T3 cells expressed the receptors for these chemokines, we performed PCR. Bands were obtained using RNAs of MEF1F2 and NIH3T3 cells (
We tested whether several signaling pathways which are widely studied are activated upon stimulation by these cytokines. As shown in
was also activated. However, Akt and NFκB monitered by phosphorylation of IκB remained inactivated. We also monitored some other signaling molecules such as PKCα but none of them were activated (data not shown).
To see which pathway is related to fast growth of the cells, we used inhibitors for the signaling pathways and test growth stimulation activities of the cytokines. As shown in
contribute to fast growth of the cells should be studied in the future.
Chemokines function as chemo-attractants during the process of inflammation. Moreover, they stimulate growth of some immune cells. However, their effects on the neighboring fibroblasts have not been fully appreciated. In this paper, we found that certain chemokines secreted from macrophages can stimulate growth of fibroblasts. The role of this activation is unclear, but it is possible that the growth of fibroblasts can support immune cell activity at the site of inflammation.
CCL12, CxCL2, and CxCL10 showed growth stimulation activity. To make sure that only CCL12, CxCL2, and CxCL10 have the activity, we cloned the genes for CCL2, CCL5, CCL12, CxCL2, and CxCL10 and expressed the proteins in 293T cells. Again CCL2 and CCL5 did not show the activity and other three showed significant activity, confirming the results of bacterially expressed protein.
The cells, which are stimulated with CCL12, CxCL2, and CxCL10 maintained contact inhibition activity, al- though the saturation cell number was bigger than that of the untreated cells. Therefore, the cells grow faster but they are not transformed. However it is possible that continuous activation of the cells might transform the cells. Further study is required to get the conclusion of this question.
The interplay between chemokines and their corresponding receptors is complex. We found that CCR2, CCR3, CCR5, CxCR2, and CxCR3 are expressed in MEFs and NIH3T3 cells, however the complex interplay of signaling networks downstream of these receptors have complicated the functional analysis of chemokines. We found that the MAP kinase and p38 MAP kinase pathways were important for the cells to grow fast, however Akt and NFκB were not. CCL12, CxCL2, and CxCL10 take different receptors however the signaling was very similar, suggesting that these receptors play a similar role for signal transduction. Here, we found that CCL2 and CCL12 elicit distinct biological responses, although they bind to the same receptor. Why CCL2 does not show growth stimulation activity is a mystery. It is possible that CCL12 reacts with unknown receptor which is required for cells growth or CCL2 reacts with another unknown receptor which inhibits stimulation of cell growth. For instance, activation of CCR5 might inhibit fast growth of the cells.
In this study we found that chemokines, CCL12, CxCL2, and CxCL10 can stimulate growth of fibroblasts. However, they have to be added every day maybe because of their instability. Therefore, Cell growth of normal fibroblasts will be stimulated only when chemokines are supplied by macrophages in vivo. For the fast growth of the cells, activation of the ERK and 38 MAP kinase pathways was required. However, cell growth of transformed cells was stimulated, and probably the ERK and the 38 MAP kinase pathways are already activated. Stimulation of growth of fibroblasts may be limited to very specific condition, which we do not know yet. It is interesting that there are appropriate concentrations of chemokines to stimulate the cell growth. This result may implicate that there is a fine regulation of growth of fibroblasts by macrophage. This may be an important finding to consider what is happening in vivo. Further study is required to understand the meaning of the observation we made in this paper.
This paper is supported by a grant from the National Health Research Institute: 01A1-CSPP04-014 and from the National Science Council Taiwan: 101-2300-B-400-015.
Jing-Yang Lai,Chung-Li Shu,Kazuhiro Morishita,Tomonaga Ichikawa,Yasuhisa Fukui, (2014) Raw264.7 Cells Secrete Fibroblast Growth Stimulating Activity after Differentiation to Macrophages by Stimulation with Lipopolysaccharide. CellBio,03,87-95. doi: 10.4236/cellbio.2014.33009