MUC1, a tumor-associated antigen overexpressed in many carcinomas, represents a candidate of choice for cancer immunotherapy. Flagella-based MUC1 vaccines were tested in therapeutic setting in two aggressive breast cancer models, comprising the implantation of the 4T1-MUC1 cell line in either Balb/c, or Human MUC1 transgenic mice in which spontaneous metastases occurs. Recombinant flagella carrying only 7 amino acid of MUC1 elicited therapeutic activity, affecting both the growth of established growing tumors and the number of metastases. Higher therapeutic activity was achieved with an additional recombinant flagella designed with the SYFPEITHI algorithm. The vaccines triggered a Th1 response against MUC1 with no evident autoimmune response towards healthy MUC1-expressing tissues. Recombinant flagella carrying a 25-residue fragment of MUC1, induced the most effective response, as evidenced by a significant reduction of both the size and growth rate of the tumor as well as by the lower number of metastases, and expanding life span of vaccinated mice.
In spite of pronounced improvements in cancer management over the last decade, traditional cancer treatments remain limited in their therapeutic capacity and are accompanied by adverse side effects. There is therefore a pressing demand for new therapeutic approaches. Cancer vaccines, based on tumor associated-antigens, represent an attractive therapeutic strategy. They are aimed at inducing a specific immune response towards the tumor, they are usually not associated with toxic side effects and they can establish a long-term immune memory, which is critical in preventing tumor recurrence [
The tumor associated antigen mucin 1 (MUC1) is a high molecular weight transmembrane glycoprotein expressed on the apical surface of most of the glandular epithelial cells [
The carrier system employed in this study has been designed to stimulate the immune response to linear epitopes by their expression in flagellin, the structural subunit of the flagellum filament [
In the present study, we explored the potential use of several epitope-based recombinant flagella vaccines targeting the extracellular TR sequence of MUC1, selected using the SYFPEITHI database [
The 4T1-MUC1 cell line was kindly provided by Prof. T.M. Allen (University of Alberta, Edmonton, Canada) [
Female Balb/c mice (8 weeks old) were purchased from Harlan Laboratories (Jerusalem). Human MUC1 transgenic mice (C57BL/6) were kindly provided by Prof. Gendler S. (Mayo Clinic, Scottsdale, AZ). These transgenic mice express the human MUC1 in the same pattern as humans do and are tolerant to the human MUC1 [
PCR was used to routinely identify MUC1 transgenic positive mice during the successive crossing. PCR was carried out in a total volume of 50 μL with the following reagents: 0.65 μM 5’-CTTGCCAGCCATAGCACCAAG-3’ (bp 745 - 765) and 0.65 μM 5’-CTCCACGTCGTGGA CATTGATG-3’ (bp 1086 - 1065) primer, 10 μL of ready mix (Larova), 1 μL of tail DNA and DDW. The amplification program consisted of one cycle of 10 min at 94˚C and 40 cycles of 1 min each at 94, 61 and 72˚C. The PCR product of each reaction was analysed by size fractionation through a 1% agarose gel. Amplification of MUC1 positive DNA resulted in a 500 bp fragment.
The following oligonucleotides were synthesized:
the oligonucleotide 5’-GCT CCG GAT ACC CGT CCG GCT GAT-3’ coding for the 7 amino acids epitope APDTRPA (MUC1.7), the oligonucleotide 5’-AGA CCG GCT CCG GGT AGC ACC GCT CCG GAT-3’ coding for the 9 amino acids epitope RPAPGSTAP (MUC1.9) identified by the SYFPEITHI database, and the oligonucleotide sequence of 25 amino acids GVTSAPDTRPAPGSTAPPAHGVTSA (MUC1.25) 5’-GGCGTGACCTCGGCGCCGGAT ACCCGCCCGGCGCCGGGCTCGACCGCGCCGCCGGCGCATGGCGTGACCTCGGCG-3’. For the two first oligonucleotides the last 3 nucleic acids GAT were added in order to preserve the EcoRV restriction site in the flagellin sequence. Codon usage was according to the sequence of the flagellin gene.
The plasmid vector carrying the flagellin gene from Salmonella munchen pls408 (Newton S. M., Jacob C. O., Stocker B. A., 1989, Science. 244: 70-2) was used for the expression of the epitopes MUC1.7 and MUC1.9 at the EcoRV restriction site. For the insertion of MUC1.25, the plasmid pls408 was slightly modified by mutagenesis (Stratagene) to create an Age I restriction site 21 bp in 5’ of the EcoRV site. The recombinant plasmids were transformed into E. coli JM101 competent cells by heat chock. Plasmids from positive colonies were purified and used to transform a flagellin negative live vaccine strain (an Aro A mutant) of S. Dublin SL5928 by electroporation. The transformed S. Dublin cells were selected for Ampicillin resistance, motility under the light microscope and growth in semisolid agar plates. The flagella comprising the hybrid flagellins were detached from the bacteria using acidic cleavage as described elsewhere (Ibrahim et al.). The purity of the isolated peptides was assessed by SDS-PAGE.
The recombinant flagellin harbouring MUC1.7 was denoted Fla-MUC1.7, the flagellin carrying MUC1.9 was denoted Fla-MUC1.9, the flagellin carrying MUC1.25 was denoted Fla-MUC1.25 and a flagellin bearing a non relevant peptide (TYQRTRALVRTG) was denoted FlaNRP and serves as a control vaccine.
In the prophylactic immunization experiment, female Balb/c mice (8 weeks old) were immunized subcutaneously (s.c.) 3 times at 4 weeks intervals with Fla-MUC1.7 (100 μg/ mouse), Fla-NRP (100 μg/mouse) or PBS in adjuvant (complete Freund’s adjuvant for the first immunization and incomplete Freund’s adjuvant for the boosts, both supplied by Sigma). Four months after the last immunization, 1.5 million 4T1-MUC1 tumor cells were subcutaneously implanted in a total volume of 100 mL.
In therapeutic vaccination experiments, mice were implanted subcutaneously (s.c.) with 1.5 million 4T1-MUC1 cells in a total volume of 100 μl in PBS. Around two weeks post-implantation, the average tumor size was around 0.1 cm3 in each group, and immunization was performed such as 100 mg of Fla-MUC1.7 or 100 mg of Fla-MUC1.9 or 50 mg of each of them (when used in combination), or 100 mg of Fla-MUC1.25, or Fla-NRP, or PBS, were administrated to the mice bearing tumor. The dose of 100 mg was selected as optimal after a dose range finding experiment using doses ranging from 20 to 200 mg. Fifty micrograms was identified as the minimal therapeutic effective dose, whereas 200 mg seemed less tolerated by the mice.
The average tumor growth was calculated as the difference between the tumor size on a given day and the tumor size on the first day of immunization. Variability in tumor growth inter experiments was observed. The end of each experiment was dictated by the time when mice became moribund.
The area on the back of each mouse, where tumor cells were implanted as described in Section 2.5 was first inspected visually to localise the formed mass. The initial detection of the tumor mass was either confirmed or further performed by palpation. Furs on and around the tumor were cut as short as possible in order to facilitate and maximize the accuracy of the tumor measure. The tumor volume was determined using the equation: volume = 0.4 ab2, where a and b are respectively the larger and the smaller diameter of the tumor, measured using a calliper.
Tumor bearing mice were bled from the heart around 20 days post-immunization. Mice “non bearing tumor” were immunized s.c. 3 times 4 weeks intervals with 100 mg of Fla-MUC1.7, or 100 mg of Fla-MUC1.9, or 50 mg of Fla-MUC1.7 + 50 mg of Fla-MUC1.9, or 100 mg of Fla-NRP, or PBS, with adjuvant (first immunization in CFA and further boost in IFA). Bleeding from the eye were performed 2 weeks after each immunization. ELISA was performed using Nunc Maxisorp plate coated overnight at 4˚C with BSA coupled to the 20 amino acids sequence of the tandem repeat of MUC1 GVTSAPDTRPAPGSTAPPAH (10 mg/well in 100 mL). The plate was washed twice with PBS containing 0.1% Tween-20 (PBS-Tween). The wells were then blocked with 1% BSA in PBS for 1 h at 37˚C, and washed with PBS-Tween. The serum obtained from mice of each group was pooled and 50 mL samples were added in duplicate. The plates were incubated for 2 hours at 37˚C, and washed in PBS-Tween. Goat anti-mouse IgG2a, IgG3 (conjugated to horseradish peroxidase-HRP) or IgG1 (conjugated to alkaline phosphase-AP) were used as second antibodies (Jackson Laboratories). 3.3’,5,5’- tetramethylbezidine (TMB, Sigma) and alkaline phosphatase substrate solution (Sigma) were added as substrate. Following the addition of the substrate (50 mL/ well), the reaction was allowed to proceed, and was terminated by adding 50 mL of 1HCL (for HRP) or 15 mL of 3N NaOH (for AP). The intensity of colour was subsequently determined at 450 nm and 405 nm, respecttively by an ELISA reader (Multiscan MCC/340 MK II, Lab system).
Female Balb/c mice (8 weeks old) were s.c. immunized 4 times 4 weeks intervals with 50 μg per mouse of each of Fla-MUC1.7 and Fla-MUC1.9, or Fla-NRP, or PBS with adjuvant (first immunization with complete Freund’s adjuvant, and further boosts in incomplete Freund’s adjuvant both from Sigma). Ten days after the last immunization, spleens were removed and the INFγ secretion assay and IL-4 secretion assay using Miltenyl Biotec kit. Splenocytes were stimulated for 16 hours at 37˚C with 5 × 105 killed 4T1-MUC1 cells (by several freeze thaw cycles) in RPMI (Gibcobrl, Life Technologies) supplemented with 5% fresh Balb/c mouse serum. The rest of the procedure was performed according to the manufacturer’s instructions.
The histopathological analysis was performed on few of the organs expressing MUC1: the lung, the liver and the kidneys. MUC1 transgenic mice bearing tumor were immunized with 50 mg of Fla-MUC1.7 + 50 mg of FlaMUC1.9 or PBS, 10 days post-immunization and the organs of interest were taken out 21 days post-immunization. The naive MUC1 transgenic animals (i.e. non-bearing tumor) were immunized 4 times 4 weeks intervals with the same preparation as in tumor-bearing mice, with adjuvant (first immunization with CFA and further boosts in IFA). The same organs of interest were removed 4 weeks after the last immunization. A phosphate buffered 4% paraformaldehyde fixative were used overnight RT. Histological sections were prepared and staining with hematoxylin and eosin were made by the histology unit of Weizmann Institute. The presence of any symptoms of autoimmunity, such as architectural damage or cellular infiltrate was searched under light microscopy.
Normality was tested using the test of Shapiro-Wilk on each group at each time point. The program SAS was used to perform a two way (or factorial) ANOVA (factors being time and treatment) with repeated measure on one factor (time) finding that an interaction one way ANOVA twice. Once comparing the treatment per each time point in which case subject was treated as blocks, and once comparing time per each treatment. Significant results were followed by Fisher’s LSD multiple comparison.
In order to validate the potential use of recombinant flagella as a MUC1-based cancer vaccine, we initially tested the therapeutic capacity of a recombinant vaccine denoted Fla-MUC1.7 carrying the 7 residues immunodominant epitope (APDTRPA) [3-6]. The administration of Fla-MUC1.7 was carried out in groups of mice bearing each a tumor of average size 0.1 cm3, formed 15 days post-implantation of 4T1-MUC1 cells. Tumor growth was calculated by the difference between the tumor size on a given day and the tumor size on the day of immunization (which defines the day 0 of the experiment). Twelve days post-immunization (which is equivalent to 27 days post-implantation of 1.5 × 106 4T1- MUC1 cells), the tumor growth was 3-fold lower as a result of the single administration of Fla-MUC1.7 compared to the growth monitored in control mice immunized either with a control recombinant vaccine denoted Fla-NRP (for non relevant peptide) or with PBS (p < 0.05) (
To further assess the efficacy of Fla-MUC1.7 in reducing tumor growth, another breast cancer animal model was used, consisting of implanting the same tumor cells (4T1-MUC1) in offspring obtained upon crossing human MUC1 transgenic mice and Balb/c mice. MUC1 transgenic mice (F1), bearing each a 4T1-MUC1 tumor of average size 0.1 cm3 (10 days after cells implantation),
were immunized either with Fla-MUC1.7 or with FlaNRP. Sixteen days later, the tumor growth was 6 times smaller in immunized mice as compared to animal administered with the control Fla-NRP (p < 0.01) (
In contrast to vaccines for infectious diseases, which are used in prophylaxis, the major application of cancer vaccines would be therapeutic (i.e. after cancer diagnosis). However, prophylactic cancer vaccination could satisfy the unmet medical need of at-risk subjects (e.g. carriers of mutation on BRCA1 or BRCA2) for whom frequent surveillance, preventive chemotherapy or total mastectomy are the only alternatives at present. It was therefore of interest to explore the prophylactic activity of FlaMUC1.7.
Balb/c mice were injected 3 times with Fla-MUC1.7, Fla-NRP, or PBS, and were challenged with 4T1-MUC1 cells 4 months after the last immunization, in order to assess whether the vaccine could ensure a long-term protection. Tumor appearance was delayed to 14 days after implantation in mice immunized with Fla-MUC1.7, whereas in the control groups (PBS or Fla-NRP) the tumors were detected already after 7 days (
The rationale behind the design of Fla-MUC1.7, as a vaccine for MUC1 expressing cancers, relies on the recruitment of a certain immune repertoire against the 7 amino acid of the TR of MUC1 expressed on tumor cells. Therefore, we examined whether immunization with FlaMUC1.7 together with another recombinant Flagella MUC1-based preparation, aimed at recruiting a different immune repertoire, would have an additive therapeutic effect.
Using the MHC binding prediction software SYFPEITHI [
Mice bearing a 4T1-MUC1 tumor of average size 0.1 cm3 were immunized with either one of the vaccines (Fla-MUC1.7 or Fla-MUC1.9) or with the combined preparations. Mice immunized with Fla-MUC1.7 or FlaMUC1.9 alone display a similar tumor growth, which were approximately 2 fold smaller than in the PBS control group (p < 0.01) (
The therapeutic efficacy upon the injection of FlaMUC1.7 alone or in combination with Fla-MUC1.9 described in
MUC1.7 plus Fla-MUC1.9 was similar to tumor size on the first day of immunization, and its rate of growth was rather slow. When immunizations were discontinued and tumor growth was accelerated, 38 days after the first immunization, or 24 days after the last vaccination, the mice immunized with Fla-MUC1.7 and Fla-MUC1.9 had to be euthanized too. But, as shown, the life span of mice vaccinated with Fla-MUC1.7 and Fla-MUC1.9 was more than doubled as compared to control mice.
The flagellin is a ligand associated with the Toll like receptor 5, which belongs to the Toll-like receptors family well documented to favour a Th1 response [
To elucidate the immune mechanism triggered by the administration of Fla-MUC1.7 and Fla-MUC1.9, we assessed the percentage of splenocytes collected from Balb/c mice immunized either with the combined vaccines, or with a control preparation (Fla-NRP) or with PBS, secreting INFγ or IL-4 in response to in vitro stimulation with 4T1-MUC1 pre-killed cells. As depicted in
with Fla-MUC1.7 and Fla-MUC1.9. We could also notice a slight higher proportion of splenocytes secreting IL-4 in mice immunized with the combined preparation (0.3%) as compared to the PBS control group (0.18%), but the significance of this difference is unclear. These data demonstrate the induction of Th1 type response towards MUC1 upon vaccination with Fla-MUC1.7 and Fla-MUC1.9.
Another aspect of the type of immune response generated by Flagellin MUC1-based cancer vaccines is reflected in the antibody isotypes profile anti-MUC1 in the serum of MUC1 transgenic mice bearing tumors that were either immunized with Fla-MUC1.7 and Fla-MUC1.9 or administered with PBS. In order to characterize the spontaneous immune response of these transgenic mice to 4T1-MUC1 tumor cells, the level of antibodies was compared to that of naive mice that were not exposed to the tumor cells. The results displayed in
towards MUC1 in MUC1 transgenic mice. IgG2a antiMUC1 was detected only in mice immunized with the combined vaccine (p < 0.01). This finding is in accord with the conclusion based on cytokines profile (Section 3.3.1) that Fla-MUC1.7 and Fla-MUC1.9 induce a Th1 type response against MUC1.
A major concern regarding the application of cancer vaccines, based on epitopes of tumor-associated antigens, is the risk of inducing an autoimmune response towards healthy organs. From this particular aspect, MUC1 presents the non-negligible advantage that its normal and malignant forms are distinguished by the immune system [
In order to design a recombinant flagellin MUC1-based vaccine that would be effective in a wider human population independently of their HLA haplotypes, a larger portion of the extracellular domain of MUC1, including several epitopes, has to be inserted into the flagellin. By using the SYFPEITHI algorithm, a 25 amino acids sequence GVTSAPDTRPAPGSTAPPAHGVTSA was selected and the corresponding recombinant vaccine Fla-MUC1.25 was constructed. The therapeutic activity of Fla-MUC1.25 on the established tumor was compared to that of the combined Fla-MUC1.7 and Fla-MUC1.9 vaccine. Balb/c mice bearing tumors of average size 0.1 cm3 were immunized with these different preparations or with PBS alone. Thirty eight days post injection, tumors grew on average to a size of more than 0.8 cm3 in the PBS control group, whereas in mice immunized with
Fla-MUC1.7 and Fla-MUC1.9 tumor reached the size of 0.4 cm3 (
Cancer vaccines based on tumor associated-antigens represent an attractive therapeutic strategy as 1) They are aimed at inducing a specific immune response towards the tumor; 2) They are usually not associated with toxic effects; and 3) They can establish a long-term immune memory towards the tumor, which is critical for the prevention of tumor recurrence. The tumor associated antigen MUC1 is overexpressed in 90% of breast cancers and in many other carcinomas such as lung, colorectal, pancreatic, ovarian and prostate cancer. The antigenicity of MUC1 differs between malignant and normal tissue, therefore a MUC1-based cancer vaccine, if effective, could hold a great promise and would be highly valuable in medical oncology.
In this study, we demonstrated the therapeutic activity of several recombinant vaccines expressing different epitopes of MUC1 in flagellin, on both tumor growth and metastases formation. The results with Fla-MUC1.7 are especially interesting considering that this chimeric vaccine carries only a 7 amino-acid MUC1 epitope. The results with the prophylactic immunization show the efficacy of Fla-MUC1.7, after an initial delay of tumor growth in all experimental groups probably due to the use of adjuvant. However, Moreover, the therapeutic activity of this recombinant MUC1-based vaccine didn’t require an external adjuvant. This finding is supported by the already described adjuvant effect of the flagellin and represents a considerable advantage for a potential human application [8,11,20]. The SYFPEITHI software was used for the design of Fla-MUC1.9, expressing a 9-amino acid epitope chosen based on its HLA recognition. This construct also demonstrated efficacy in therapeutic vaccination.
Moreover, the combined administration of the two recombinant Flagella MUC1 vaccines, Fla-MUC1.7 and Fla-MUC1.9, led to an additive therapeutic effect. Finally, Fla-MUC1.25, also designed using this database in order to expand the target population to which this new therapeutic approach could be offered, exerted even higher effect on tumor growth, number of lung metastasis and survival.
In some of the experiments, the control construct FlaNRP expressing a non-relevant epitope displayed an anti-tumor activity, though of lower level, in Balb/c mice. This effect might be due to the enhancement, by the flagella, of the existing immune response developed by the Balb/c host towards the foreign molecule (MUC1) expressed on the tumor. This is essentially an adjuvant effect of the flagella. Similar observations were reported by another research group [
The immune response triggered by the flagellin via its ligand the Toll-like receptor 5 is controversial in the literature, and body of data demonstrated the induction of either Th1 or Th2 type response [22-25]. The discrepancy of these observations might be due to the experimental conditions. In our study, we showed that the recombinant flagellin evoked a Th1 response toward the inserted epitope, as evidenced by the INFγ secretion by lymphocyte isolated in response to MUC1 stimuli, whereas the Th2 response appeared weak.
The use of flagella as a carrier for epitope expression encounters a certain limitation: for its activity to be sustained, the flagellin three-dimensional structure must be conserved [
One mechanism used by tumor cells to escape the immune system is the down-regulation of expression of MHC class I molecules [
It should be borne in mind that the vaccines described in our study were tested and evinced therapeutic activity in a particularly aggressive animal model. Indeed, the 4T1-MUC1 line is capable to form a tumor upon implantation into Balb/c mice, whereas usually the immunogenicity of MUC1 does not allow MUC1-expressing tumor cells to grow in wild-type mice [
In this study, we investigated the possible advantage of a multiple immunizations schedule, over a single administration of the vaccine. The specific schedule consisting of 3 immunizations at weekly intervals didn’t achieve higher therapeutic capacity than the single administration. The design of such study met a non negligible limitation associated with the aggressiveness of the models used in this study. Indeed, the rapid growth of the tumor required euthanasia and thus ending of the experiment within a relatively short time after the initial tumor detection (which occurred 2 weeks after tumor cell implantation). Consequently, a schedule consisting of at least a few weeks intervals between administrations of the vaccine, in order to allow the immune response to go down before the booster immunization, couldn’t be explored.
The strategy based on the recombinant flagella MUC1- expressing vaccine offers two significant advantages: first, no adjuvant is required in the therapeutic application. This is a highly advantageous feature since new, safer and more efficient adjuvants adequate for human application have yet to be developed [
It is crucial to emphasise that our data demonstrate that recombinant flagella-MUC1-based cancer vaccines are efficient agents against solid growing tumors. It would be reasonable to assume that these vaccines will be efficacious in additional animal models for other MUC1 expressing tumors, such as the lung, liver or pancreas for which the current prognosis is very poor.
We thank Prof. S Gendler (Mayo Clinic Arizona, Scottsdale, USA) for generously offering the human MUC1 transgenic mice and Prof. Allen T. (University of Alberta, Edmonton, Canada) for kindly giving us the 4T1-MUC1 cell line.