Alkaline phosphatase-positive cells isolated from human hearts have mesenchymal stem cell characteristics

doi:10.4236/scd.2011.13008

Paper Menu >>

Journal Menu >>

Vol.1, No.3, 71-80 (2011)

doi:10.4236/scd.2011.13008

Stem Cell Discovery

Alkaline phosphatase-pos itive cells isolate d from

human hearts have mesenchymal stem cell

characteristics

Alessandra Melo de Aguiar1*, Crisciele Kuligovski1,

Marise Teresinha Brenner Affonso da Costa2, Marco Augusto Stimamiglio1,

Carmen Lúcia Kuniyoshi Rebelatto3, Alexandra Cristina Senegaglia3,

Paulo Roberto Slud Brofman3, Bruno Dallagiovanna1, Samuel Goldenberg1,

Alejandro Correa1

1Carlos Chagas Institute, Oswaldo Cruz Foundation, FIOCRUZ, Curitiba, Brazil;

*Corresponding Aut hor: ale_aguiar@tecpar.br

2Human Heart Valve Bank of Charity Hospital of the Brotherhood of Santa Casa de Misericordia de Curitiba, Curitiba, Brazil;

3Core for Cell Technology, Pontifícia Universidade Católica do Paraná, Curitiba, Brazil.

Received 3 September 2011; revised 30 September 2011; accepted 11 October 2011.

ABSTRACT

Tissue-specific resident cells have been identi-

fied as a promising population of progenitor cells

for cell-based therapies. We describe here the

isolation from adult human hearts of tissue

nonspecific alkaline phosphatase-positive cells

(ALPL+ cells) with mesenchymal stem cell (MSC)

characteristics. Samples from 24 adult cadav-

eric donors were obtained from a valve bank.

Mean total ischemia time was 21.5 ± 9.1 hours.

The success rate for the isolation of human

heart-derived cells by the explant culture tec-

hnique was 70% for the right auricle (14 of 20

trials) and 33% for the right ventricle (7 of 21 tri-

als). The total auricle-derived cell population

(TAD) was used for the purification of ALPL+

cells. TAD and ALPL+ cells expressed markers

for MSC and pericytes. TAD cells and ALPL+

cells differentiated into adipocytes, osteoblasts

and chondroblasts, and ALPL+ cells expressed

markers of these three lineages more strongly

than TAD cells, as shown by RT-PCR. This po-

pulation therefore has a greater potential for dif-

ferentiation into mesechymal lineages than TAD

cells. Both cell populations express some mark-

ers of cardiac progenitors, such as GATA4,

CD117 and VEGF. ALPL+ cells expressed tro-

ponin T and ABCG2, which are also markers of

the cardiac lineage. Heart samples from tissue

banks could be considered as sources of MSC

with putative commitment towards cardiac lin-

eages, even af ter prolonged ischemia times.

Keywords: Alkaline Phosphatase; Mesenchymal

Stem Cell; Pericyte; Heart; Cell Differentiation

1. INTRODUCTION

Mesenchymal stem cells (MSC) have been identified

as a promising population of progenitor cells for cell-

based therapies for the repair of mesenchymal tissue.

Under appropriate conditions, they may give rise to vari-

ous cell types with potential therapeutic applications, in-

cluding osteoblasts, chondrocytes [1,2] and cardiomyo-

cytes [3-5]. Several sources of MSC have been identified,

including bone marrow [6], adipose tissue [7], umbilical

cord blood [8] and heart tissue [9,10].

MSC are characterized by the conditions required for

their culture, their capacity to differentiate and a panel of

various immunophenotyping markers, many of which

are also expressed by fibroblasts and other cell types

[11]. Several proteins have been identified as markers of

the MSC population, for use alone or in combination

with other markers. These proteins include mesenchymal

stem cell antigen-1 (MSCA-1) [12]. This marker has

recently been shown to be identical to tissue nonspecific

alkaline phosphatase [13].

Alkaline phosphatase is a dimeric enzyme catalyzing

the hydrolysis of phosphomonoesters, resulting in the

release of inorganic phosphate from biomolecules [14].

This enzyme is present in all organisms and in many hu-

man tissues. Four isoforms have been described in hu-

mans: intestinal, placental, germ cell, and tissue nonspe-

cific alkaline phosphatase [14]. Tissue nonspecific al-

kaline phosphatase is a phosphatidylinositol-linked pla-

sma membrane glycoprotein, which can therefore be us-

ed as a cell marker for immunophenotype characteriza-

A. M. de Aguiar et al. / Stem Cell Discovery 1 (2011) 71-80

tion and selection. This protein is a well known marker

of embryonic stem cells (ESC) [15,16]. It is also a ma-

rker of neuron progenitor cells in mice [17]. Alkaline

phosphatase-positive cells have also been identified as

myogenic progenitor cells in human skeletal muscle, in

which they were identified as pericytes [18]. Alkaline

phosphatase has also been described as a perivascular

marker present in MSC from the endometrium [19]. In-

deed, the perivascular niche and the pericyte population

have now been identified as possible MSC niches, as

reviewed [20].

MSC can be isolated from the human heart, but it re-

mains unclear whether the population of cells enriched

in tissue nonspecific alkaline phosphatase has the same

characteristics. In this study, we isolated and purified

tissue nonspecific alkaline phosphatase-positive cells fr-

om heart tissue from cadaveric adult humans provided

by a valve bank. We evaluated the characteristics of the-

se cells as possible heart-derived MSC.

2. MATERIALS AND METHODS

2.1. Collection of Human Cardiac Muscle

Tissue

Human cardiac muscle tissue was obtained from the

human heart valve bank of Charity Hospital of the Bro-

therhood of Santa Casa de Misericordia de Curitiba, in

accordance with the rules of the Oswaldo Cruz Foun-

dation ethics committee (approval number 419/07). This

investigation, carried out on human tissues, conformed

to the principles outlined in the Helsinki Declaration.

Tissue samples from the right auricle and/or right ventri-

cle were collected from cadaveric donors were placed in

F12 nutrient mixture supplemented with 2 mM L-gluta-

mine (GibcoTM Invitrogen Corporation, USA), 100 IU/

ml penicillin, and 0.1 mg/ml streptomycin (Sigma, USA ).

Tissue samples were maintained at 4˚C for no longer

than 48 hours before processing.

2.2. Isolation and Culture of Human

Heart-Derived Cells by Explant Culture

Human heart-derived cells were isolated by explant cul-

ture. In brief, heart tissues were rinsed in HBSS (Hanks

balanced salt solution) and their mass was determined.

We then used scalpels to dissect 500 to 900 mg of tissue

into fragments 1 - 2 mm3 in size.

We cultured about 100 mg of tissue fragments in each

25 cm2 culture flask (TPP, Switzerland). The tissue frag-

ments adhered to the culture flasks coated with collagen

film (Sigma, USA) after incubation at 37˚C for one hour,

in a humidified atmosphere containing 5% carbon diox-

ide. We then added culture medium. The composition of

the maintenance medium was similar to that previously

described [18], consisting of MegaCell™ DMEM (Si-

gma, USA) supplemented with 5% fetal bovine serum,

2 mM L-glutamine (GibcoTM Invitrogen Corporation,

USA), 5 ng/ml basic fibroblast growth factor, 0.1 mM β-

mercaptoethanol, 1% non essential amino acids, 100

IU/ml penicillin and 0.1 mg/ml streptomycin (Sigma,

USA).

The tissue fragments were cultured for 15 to 30 days,

with the replacement of 50% of the medium weekly.

After the cells had migrated from the explants, they were

harvested by digestion with 0.025% trypsin (GibcoTM

Invitrogen Corporation, USA) in 0.02% EDTA (Sigma,

USA). Tissue fragments were separated from the cell

suspension by passage through a cell strainer with a 40

µm mesh (BD FalconTM, USA). Cells were plated at a

density of 0.2 - 0.5 × 104 cells/cm2. Cultured cells from

passages 2 to 6 were use d for al l expe ri ments.

2.3. Purification of Alkaline

Phosphatase-Positive Cells

For the selection of tissue nonspecific alkaline phos-

phatase-positive cells (ALPL+), the total auricle-derived

cell population (TAD) was incubated with a biotin ylated

antibody directed against the human tissue nonspecific

alkaline phosphatase (R&D Systems, USA). ALPL+

cells were purified with the CellectionTM anti mouse

IgG kit (Invitrogen Dynal AS, Norway), in accordance

with the manufacturer ’s instructions. Purified cells were

cultured in maintenance medium and subjected to im-

munophenotyping, gene expression analysis and differ-

entiation assays.

2.4. Immunophenotyping by Flow

Cytometry

Flow cytometry data were acquired and analyzed as

previously described [2]. Briefly, 2 × 105 human heart-

derived cells from passages 2 to 6 were labeled with

antibodies against the following human proteins: CD90,

CD14, HLA-DR, CD73 and CD140b (BD Pharmingen,

San Jose, CA, USA) CD31, CD45, CD34 and CD133/1

(Miltenyi Biotec, Germany), CD105 and CD117 (E-bio-

science, USA), tissue nonspecific alkaline phosphatase (R

&D Systems, USA), and nestin (BD Pharmingen, USA).

For intracellular staining, cells were permeabilized with

Fix&Perm reagent (Caltag Laboratories, USA), in accor-

dance with the manufacturer’s instructions. Mouse iso-

type IgG1 antibodies were used as controls (BD PHAR-

MINGEN™, USA). About 10,000 labeled cells were ac-

quired with a FACSCalibur flow cytometer (Becton

Dickinson, USA) and analyzed with FlowJo software

(Flowjo, USA).

A. M. de Aguiar et al. / Stem Cell Discovery 1 (2011) 71-80

7373

2.5. Differentiation into Mesenchymal

Lineages

TAD and ALPL+ cells were evaluated by inducing

their differentiation into adipocytes, osteoblasts and cho n-

droblasts, as previously described [2]. Cells between

passages 2 and 6 were incubated with control main-

tenance medium or differentiation induction medium for

21 days. Cells were then fixed for morphological eval-

uation by standard staining procedures, with Oil Red for

adipogenesis, Von Kossa staining for osteogenesis and

toluidine blue staining for chondrogenesis [2]. We also

performed RT-qPCR to estimate the level of differentia-

tion-specific mRNA in induced TAD and ALPL+ cells.

We analyzed adipogenic differentiation quantitatively, by

counting cells from three biological replicates of TAD

and ALPL+ cells, with analysis by ImageJ versio n 1.45d.

2.6. Evaluation of Gene Expression by

RT-qPCR

Total RNA was obtained with the RNeasy kit (QIA

GEN, USA) and samples were treated “in column” with

DNAse I (QIAGEN, USA), in accordance with the manu-

facturer’s instructions. Complementary DNA (cDNA) was

synthesized from 1 µg of total RNA, with oligo-dT pri-

mers (USB Corporation, USA) and a reverse transcrip-

tase kit (IMPROM II, Promega, USA), according to the

manufacturers’ instructions. PCR was carried out as pre-

viously described [2,25,23] The primer sets and PCR

conditions are listed in Table 1.

2.7. Statistical Analysis

Donor age and total ischemia time are expressed as

means ± standard deviation. All other data are expressed

as means ± standard error for three or more biological

replicates. We used Fisher Exact Test to compare succ-

essful cell isolations from auricle or ventricle samples.

We used Student’s t-test to compare other samples (p <

0.05 considered significant).

3. RESULTS

3.1. Isolation of Human Heart-Derived Cells

by Explant Cell Culture

We used the explant cell culture technique to isolate

hu ma n heart-derived cells from right ventricles or auricles.

Samples were obtained from 24 adult cadaveric donors

Table 1. Primer sets.

Primer Sequence (5´- 3´) Size (bp) Annealing (˚C) Reference

ALPL Forward: TGGCCCCCATGCTGAGTGACAC

Reverse: TGGCGCAGGGGCACAGCAGAC 160 55 [2]

FABP4 Forward: AT GGGATGGAAAATCAACCA

Reverse: GTGGAAGTGACGCCTTTCAT 97 60 [2]

CD44 Forward: CCCTCTTGGCCTTGGCTTTGATTC

Reverse: TTGAGTCCACTTGGCTTTCTGTCC 133 55

ACTA2 Forward: CCGGGACATCAAGGAGAAACTG

Reverse: GGTACATAGTGGTGCCCCCTGATA 277 55

TGFB1 Forward: CGTGCGGCAGCTGTACATTGACTT

Reverse: CGCCCGGGTTATGCTGGTTGT 200 55

CAD11a Forward: TCACACTGACCTCGACAGATTTTT

Reverse: AGGGGGT AGGCTGAAGATAA 331 55

FSP1 Forward: TCG GGCAAAGAGGGTGACAAGTT

Reverse: AT GGCGATGCAGGACAGGAAGAC 205 55

ABCG2 Forward: ACCATTGCATCTTGGCTGTC

Reverse: CGATGCCCTGCTTTACCAAA 233 55 [21]

Col1a Forward: GGCCATCCAGCTGACCTTCC

Reverse: CGTGCAGCCATCGACAGTGAC 205 60

Col 2 Forward: CCGGGCAGAGGGCAATAGCAGGTT

Reverse: CAATGATGGGGAGGCGTGAG 128 60 [2]

GATA4 Forward: CTCCCCTGGCAAAACAAGAG

Reverse: TGCCGTGTCTTAGCAGTCGT 422 62 [22]

CD117 Forward: CATAATGAAGACTTGCTGGGATGC

Reverse: CACGGGCTTCTGTCGG TTGG 148 55

TNNT2 For ward: AGGAGAAGTTCAAGCAGCAGA

Reverse: GCGAGCGAGGAGCAGAT 155 55 [23]

VEGFA Forward: CTACCTCCACCATGCCAAGTG

Reverse: TGCGCTGATAG ACAT CCAT G A 101 60 [23]

GAPDH Forward: GGCGATGCTGGCGCTGAGTAC

Reverse: TGGTTCACACCCATGACGA 150 60 [2]

RNApol IIa Forward: TACCACGTCATCTCCTTTGATGGCT

Reverse: GTGCGGCTGCTTCCATAA 187 60 [24]

A. M. de Aguiar et al. / Stem Cell Discovery 1 (2011) 71-80

with a mean total ischemia time of 21.5 ± 9.1 hours

(range: 2.5 to 41.8 hours). We have not found significant

statistical difference when comparing ischemia time and

successful and not successful cell isolation (data not

shown). The mean age of the donors was 39 years ±12;

54% (n = 13) of the donor s were male and 46% (n = 11)

were female. After two to four weeks of culture, cells be-

gan to migrate from the cultured explants of auricle and

ventricle tissues (Fi gures 1(a)-(b)).

Cells were successfully isolated in 14/20 trials for the

right auricle (70%) and 7/21 trials for the right ventricle

(33%) with a statistical significance of p < 0.05. Success

rates were similar for cultures of explants from male and

female donors. However, we did not find statistical sig-

nificance when comparing isolation success rates from

auricle or ventricle samples and donor age classes. We

observed a tendency of successful cell isolation in right

ventricle samples from younger donors (Figure 1(c)).

Cell isolation success rate from right ventricle samples

was 50% for younger donors, but only 17% for older

donors. Interestingly, samples from donors between the

ages of 31 and 50 gave the highest success rates for cells

isolation from right auricle samples. We obtained suc-

cess rates of 86% for donors aged 31 to 40 years and

100% for donors aged 41 to 50 years. By contrast, suc-

cess rates were lower (50%) for auricle samples from

donors between the ages of 21 and 30 years or between

the ages of 51 and 60 years (Figure 1(c)). In addition,

for 17 donors, we evaluated the isolation of human

heart-derived cells from both the right ventricle and the

right auricle. The success rates for isolation were differ-

ent for the two explants. We were able to establish cell

cultures from 12/17 (70%) auricles and 4/17 (23%) ven-

tricles. Thus, the type of tissue used seems to play an

important role in determining the success of human

heart-derived cell isolation. These data suggest that the

total auricle-derived cell population (TAD) may be a

more suitable source of heart-derived cells than the pop-

ulation of cells from the right ventricle.

3.2. Auricle- and Ventricle-Derived Cell

Cultures are Heterogeneous and

Express MSC Markers

We characterized total auricle-derived and total ven-

tricle-derived cell populations by performing RT-PCR and

flow cytometry assays. MSC/pericyte markers, such as

ALPL, CD44 and alpha smoth muscle actin (ACTA2),

were detected in the cell samples by RT-PCR (Figure

2(a)). We also found markers of myofibroblasts, such as

transforming growth factor beta 1 (TGFβ1) and cadherin

11a (Cad11a), and markers for fibroblasts, such as col-

lagen 1a (Col1A) and fibroblast-specific protein 1 (FSP1)

(Figure 2(a)). Thus, cell populations derived from auricle

(a)

(b)

(c)

Figure 1. Isolation of cells derived from human heart.

Contrast phase microscopy images, showing cells that

have migrated from the right auricle (a) and right ventri-

cle (b) after 2 to 4 weeks of primary explant culture. The

success rates for the isolation procedure are shown as a

function of tissue and donor age (c). Bars indicate age

classes. The y axis shows the percentage of successful

isolations from auricle or ventricle cardiac muscle for

each age class. The n for each age class is indicated at

the top of each bar. The calibration bar corresponds to 30

µm. *p < 0.05.

or ventricle explant cultures were heterogeneous and

RT-PCR found no difference in the pro file of marker ex-

pression between them.

However, auricle-derived cell population had higher

A. M. de Aguiar et al. / Stem Cell Discovery 1 (2011) 71-80

7575

levels of CD90 and ALPL expression than ventricle-

derived cells on flow cytometry, whereas amounts of

CD105, CD140b and CD117 were similar in both popu-

lations (Figure 2(b)). The auricle-derived cell popula-

tion may be a more suitable source of heart-derived cells

expressing tissue nonspecific alkaline phosphatase than

the right ventricle as we found larger amounts of ALPL

in auricle samples than in ventricle samples. We there-

fore used total auricle-derived cells (TAD) for subse-

quent analyses.

(a)

(b)

Figure 2. Characterization of auricle-derived

and ventricle-derived cell cultures. The expre-

ssion of markers for MSC/pericytes (ALPL,

CD44, ACTA2), myofibroblasts (TGF-, Cad11a)

and fibroblasts (FSP-1, col1a) and the expres-

sion of the housekeeping gene RNA Pol IIa were

assayed by RT-PCR, with three independent

samples at passage 4. Samples from auricle-

derived cell cultures (A) and ventricle-derived

cell cultures (V) are shown, NT (non template

control) (a) The presence of markers for peri-

cytes (ALPL, CD140b), mesenchymal stem

cells (CD90 and CD105) and cardiac progeni-

tor cells (CD117) was analyzed by flow cy-

tometry (b) At least three independent donors

were used for each marker. *p < 0.05.

3.3. The ALPL+ Cell Population Can be

Purified from Total Auricle-Derived

cells (TAD) and Has the Characteristics

and Differentiation Potential of MSC

Using magnetic microbeads, we obtained a cell popu-

lation enriched in cells expressing tissue nonspecific

alkaline phosphatase (ALPL+). A single round of purify-

cation yielded an ALPL+ enriched population of 86.4%

± 6.2% (n = 3), as quantified by flow cytometry (Figure

3(a)). We then evaluated markers of MSC, pericytes and

endothelium cells. We observed no difference in the ex-

pression of MSC/perivascular cell markers, such as CD

140b and nestin (Figure 3(b)).

We analyzed the expression of endothelial markers:

CD34 was expressed by less than 15% of cells, Von Wi-

llebrand factor (vWF) was expressed by less than 10%

of cells and other endothelial markers, such as CD133

and CD31, were not detected at all (Figure 3(c)). We

then evaluated MSC markers. Both TAD and ALPL+

cells expressed positive markers for mesenchymal stem

cells, such as CD90, CD105 and CD73 (Figure 3(d)),

and neither of these cell populations expressed negative

markers, such as CD45, CD14 and HLA-DR (Figure

3(e)). Thus, these heart-derived cell populations appear

to contain MSC-like cells in accordance with criteria

pointed out by Dominici et al. [20].

Thus, the differentiation of TAD and ALPL+ cells into

osteoblasts, adipocytes and chondroblasts was induced.

Both populations were able to differentiate along these

three lineages, indicating that MSC-like cells are present

in both TAD and ALPL+ cells, as shown by phase-con-

trast microscopy and cytochemistry (Figures 4 (a)-(b)).

The expression of fabp4, collagen 1a and collagen II,

lineage-specific markers of adipocytes, osteoblasts and

chondroblasts, respectively, was assayed by RT-qPCR

(Figure 4(c)). Fabp4, collagen 1a and collagen II mRNA

levels were higher in ALPL+ cultures than in TAD cul-

tures (p < 0.05).

We analyzed adipogenic differentiation, by staining

lipid-rich vacuoles with Oil Red O. We observed such

differentiation in 48.5% ± 16.1% of TAD cells and 69.6%

± 5.5% of ALPL+ cells, this difference being non sig nif y -

cant. TAD cells had only a few, very small intracellular

lipid droplets (Figure 4(b)), whereas ALPL+ cells were

large and round, with lipid-rich vacuoles in the cyto-

plasm (Figure 4(b)). We also evaluated the area, in pix-

els, covered by lipid-rich vacuoles stained with Oil Red

O within an arbitrarily defined region, for three inde-

pendent donors. The area covered by lipid-rich vacuoles

was significantly larger for ALPL+ cells than for TAD

(Figure 5). Thus, the adipocytes differentiated in ALPL+

cells were more mature than those in TAD cultures.

A. M. de Aguiar et al. / Stem Cell Discovery 1 (2011) 71-80

(a)

(b)

(c)

(d)

(e)

Figure 3. Purification of the ALPL+ population from auri-

cle-derived cell cultures. Isotype control, TAD cells (and the

ALPL+-enriched population after selection on micromagnetic

beads and evalution by flow cytometry, a representative ex-

periment (a) Markers for pericytes (b) Markers for endothe-

lium (c) MSC-positive Markers (d) and MSC-negative mark-

ers (e) Imunnofenotyping was evaluated in TAD (total au-

ricle-derived cell population), white bars and in ALPL+ cells

(tissue nonspecific alkaline phosphatase positive cell popula-

tion), black bars. Data are expressed as medians and standard

error (n = 3). Von Willebrand factor (vWF).

3.4. Expression of Cardiac Markers

We evaluated the expression of cardiac markers (Fig-

ure 6). Both the TAD and ALPL+ cell populations ex-

pressed GATA4, an early cardiomyogenic marker [26],

and CD117, a cardiac progenitor marker [27]. We also

observed the expression of VEGF, an endothelial growth

factor [28]. ALPL+ cells also expressed another marker of

cardiac-resident stem cells: the side population marker

ABCG2 [29,30]. In addition, these cells expressed car-

diac troponin T, anot her cardi ac lineage marker.

A. M. de Aguiar et al. / Stem Cell Discovery 1 (2011) 71-80

7777

4. DISCUSSION studied were isolated from animal models [31,32] or

from fresh material obtained during biopsies on donors

with cardiac diseases [27,33]. MSC have also previously

been isolated from human heart tissues taken from ter-

minal heart failure patients undergoing heart transplanta-

tion [9]. However, heart failure may interfere with the

homeostasis of the organ, thus affecting the putative car-

diac progenitor population, as demonstrated by Gálvez et

al. [34]. Taking these facts into account, we decided to

investigate whether MSC expressing the ALPL marker

could be isolated from human heart samples with no

heart condition related to death cause.

The aim of this study was to isolate ALPL+ cells from

human heart samples from a valve bank. We showed th at

a heart-derived cell population enriched in cells expre-

ssing tissue nonspecific alkaline phosphatase had mes-

enchymal stem cells characteristics such as plastic ad-

herence, antigenic profile and the potential to differenti-

ate into mesenchymal lineages [20]. We also showed that

heart-derived ALPL+ cells expressed a repertoire of car-

diac markers.

Alkaline phosphatase has been shown to be a marker

for MSC in bone marrow, embryonic stem cells, neuro-

nal progenitor cells, myogenic pericytes in human skele-

tal muscle and endometrial MSC-like cells [12,13,15,

17-19]. We investigated ALPL+ cells in human hearts.

In valve banks, hearts are processed for valve extrac-

tion and muscle tissue is actually discarded. We evaluated

samples with a mean total ischemia time of 21.5 ± 9.1

hours with up to 48 hours elapsing before cell isolation.

In most previous studies, the cardiac progenitor cells

(a) (b)

(c)

Figure 4. Differentiation into mesenchymal lineages. Differentiation into osteoblasts, adipocytes and

condroblasts was induced in TAD and ALPL+ cells over a period of 21 days. Phase contrast micros-

copy images were obtained (a), and cytochemistry evaluations (b) carried out. Gene expression data

are shown for the differentiation markers assayed by RT-qPCR (c). Data were collected from 3 donors.

Representative data are shown. The calibration bar corresponds to 15 µm for figure a. The calibration

bar for adipogenesis in figure b is 15 µm, and that for osteogenesis and chondrogenesis in figure b is

60 µm. Control (C) and induced (I). Fatty acid binding protein 4, adipocyte (Fabp4), collagen 1a (Col

1A) and collagen II (COL II), *p < 0.05.

Openly accessible at

A. M. de Aguiar et al. / Stem Cell Discovery 1 (2011) 71-80

Figure 5. Quantification of the lipid-rich area during adipo-

genic differentiation. The area covered by lipid-rich vesicles was

determined in arbitrary units (pixels). Data were collected from

3 donors (p < 0.05 considered significant).

We were able to isolate MSC, by the exp lant cell culture

technique, from the right auricles of human cadaveric

donors. ALPL+ cells may constitute a heart-resident po-

pulation enriched in MSC, as mRNA levels for mesen-

chymal lineage markers (osteoblasts, adipocytes and ch-

ondroblasts) were higher in ALPL+ cells than in TAD

cells induced to differentiate. Indeed, larger numbers of

adipocytes were found to be differentiating cells than in

TAD cells, and ALPL+ cells also had a higher lipid-rich

vesicle content. Thus, the tissue discarded by tissue ban-

ks may be evaluated as a source of MSC, even after pro-

longed ischemia.

ALPL expression has been observed in myogenic pre-

cursors in skeletal muscle, different from satellite cells

[18]. Thus, the ALPL+ cells described here may even

resemble the mesoangioblasts described in murine car-

diac tissue [32] and in human cardiac tissue from donors

with hypertrophic cardiomyopathies [34]. ALPL+ cells

may display some commitment to cardiac lineages, as

we have shown they express GATA4, a master gene in

cardiomyogenic and myocardial differentiation [26], the

cardiac resident stem cell marker CD117 [27], ABCG2,

a marker of the side population, and a well known mar-

ker of stem cells and cardiac stem cells [30], together

with the cardiac isoform of troponin T, a marker of the

cardiomyocyte lineage.

The expression of these markers may constitute a suit-

able characteristic for evaluation, as it may be beneficial

for cardiac lineage differentiation and for applications in

cardiovascular cell therapy. These cells may have several

advantages over other adult stem cells, because of their

tissue specificity, precommitment and potential autolo-

gous use, as suggested for other cardiac progenitor cells

[35]. We observed the expression of some cardiac mark-

ers in heart-derived MSC in this study. It therefore seems

likely that the cardiac niche plays a role in this expres-

sion. As pointed out in a review, the stem cell niche is a

Figure 6. Expression of cardiac markers. The expression of

markers for cardiac lineages, such as GATA4, CD117, ABCG2

and cardiac troponin T, the growth factor VEGF and the

housekeeping gene RNA Pol IIa was analyzed by RT-PCR for

3 independent samples of TAD cells and ALPL+ cells and a

non template control (NTC). The two cell populations had

similar expression profiles for VEGF, GATA4 and CD117.

ALPL+ cells also expressed troponin T and ABCG2 in 2 of the

3 samples analyzed.

complex, multifactorial local micro-environment [36].

The auricle appeared to be the most appropriate

source of heart-derived cells. The success rate for cell

isolation by explant culture was higher for auricle-de-

rived cells than for ventricle-derived cells. This may re-

flect differences in the responses to ischemia of the two

types of tissue. As previously reported for experimental

models, the changes induced by ischemia in atrial mus-

cle cells occur more slower than those induced in ven-

tricular muscle cells, and tissue autolysis is also slower

[37,38].

By contrast to our isolation of ALPL+ cells from hu-

man heart samples, a previous study reported an absence

of ALPL detection in MSC from human hearts [39].

These conflicting findings may reflect differences in

isolation and culture procedures. Here, we isolated cells

by the explant cell culture technique, which may have

favored the isolation of ALPL+ cells, and we used a me-

dium described for the isolation of pericytes from human

muscle tissue [18]. Cell culture enhances alkaline phos-

phatase expression in pericytes isolated from mammal-

ian hearts [40]. We may therefore have favored the isola-

tion of human heart pericytes, by selecting tissue non-

specific alkaline phosphatase-expressing cells from an

explant cell culture. By contrast, in the other study, cells

were obtained by enzymatic digestion of heart samples

from donors with heart failure [39].

The yields of the explant culture method were com-

patible with successful use in basic research. However,

they remained below 100%, and further evaluations are

required before this method can be considered for clini-

cal use in autologous therapy. Furthermore, it takes about

A. M. de Aguiar et al. / Stem Cell Discovery 1 (2011) 71-80

7979

two to four weeks to isolate the first cells and, as re-

ported here, yield varies with donor age. However, the

explant cell culture method is simple, inexpensive and

could be easily adapted for cell isolation from material

provided by tissue banks, for obtaining heart-derived

cells.

In summary, tissue and cell banks now provide hope

for improvements in the quality of life of people in need

of cell or tissue transplantation. In the future, allogeneic

cell banks for cell therapy should be evaluated, as pro-

posed by Pasquinelli et al. [41]. If a heart-derived cell

bank could be established, this might make it easier to

obtain material for cell-based therapies on the basis of a

histocompatibility match. This work provides new in-

sight into possible sources and strategies for obtaining

cells and making them available for cell therapy.

5. ACKNOWLEDGEMENTS

We would like to thank Alyne Rocha Trigo, Andressa Vaz Schittini,

Jaiesa Zych, Nilson Fidencio and Patrícia Shigunov for technical sup-

port. We also thank all the staff of Instituto Carlos Chagas-Fiocruz

Paraná for laboratory and administrative support and the staff of Banco

de Homoexertos Cardíacos Humanos for tissue collection. We thank

Itamar Crispin for graphic design. We thank Hugo Naya from Pasteur

Institute, Montevideo for statistical analysis. This study was supported

by Fundação Oswaldo Cruz, PAPES V (Grant number 0232 to AC),

Decit/SCTIE/MS, by CNPq and Fundação Araucária (Grant number

202/2010 to SG), SETI/Fundação Araucária (Grant number 480/2010

to AMA). AC holds a Finep/CNPq fellowship, SG and BD are research

fellows at the Conselho Nacional de Desenvolvimento Ci- entifico e

Tecnológico-CNPq. The authors report no potential conflicts of interest

or financial interests.

REFERENCES

[1] Gimble, J. and Guilak, F. (2003) Differentiation potential

of adipose derived adult stem (ADAS) cells. Current

Topics in Developmental Biology, 58, 137-160.

doi:10.1016/S0070-2153(03)58005-X

[2] Rebelatto, C., et al. (2008) Dissimilar differentiation of

mesenchymal stem cells from bone marrow, umbilical

cord blood, and adipose tissue . Experimental Biology and

Medicine, 233, 901-913. doi:10.3181/0712-RM-356

[3] Makino, S., et al. (1999) Cardiomyocytes can be gen-

erated from marrow stromal cells in vitro. Journal of

Clinical Investigation, 103, 697-705.

doi:10.1172/JCI5298

[4] Tomita, Y., et al. (2007) Application of mesenchymal

stem cell-derived cardiomyocytes as bio-pacemakers:

Current status and problems to be solved. Medical and

Biological Engineering & Computing, 45, 209-220.

doi:10.1007/s11517-007-0163-4

[5] Toma , C., Pi tte nger, M., Cahill, K., Byrne, B. and Kessle r,

P. (2002) Human mesenchymal stem cells differentiate to

a cardiomyocyte phenotype in the adult murine heart.

Circulation, 105, 93-98. doi:10.1161/hc0102.101442

[6] Pittenger, M., et al. (1999) Multilineage potential of adult

human mesenchymal stem cells. Science, 284, 143-147.

doi:10.1126/science.284.5411.143

[7] Zuk, P., et al. (2002) Human adipose tissue is a source of

multipotent stem cells. Molecular Biology of the Cell, 13,

4279-4295. doi:10.1091/mbc.E02-02-0105

[8] Rogers, I. and Casper, R. (2004) Umbilical cord blood

stem cells. Best Practice and Research Clinical Obstet-

rics and Gynaecolog, 18, 893-908.

doi:10.1016/j.bpobgyn.2004.06.004

[9] Beltrami, A., et al. (2007) Multipotent cells can be gen-

erated in vitro from several adult human organs (heart,

liver, and bone ma rro w) . Blood, 110, 3438-3446.

doi:10.1182/blood-2006-11-055566

[10] Crisan, M., et al. (2008) A perivascular origin for me-

senchymal stem cells in multiple human organs. Cell

Stem Cell, 3, 301-313. doi:10.1016/j.stem.2008.07.003

[11] Dominici, M., et al. (2006) Minimal criteria for defining

multipotent mesenchymal stromal cells. The International

Society for Cellular Therapy position statement. Cyto-

therapy, 8, 315-317.

doi:10.1080/14653240600855905

[12] Battula, V., et al. (2009) Isolation of functionally distinct

mesenchymal stem cell subsets using antibodies against

CD56, CD271, and mesenchymal stem cell antigen-1.

Haematologica, 94, 173-184.

doi:10.3324/haematol.13740

[13] Sobiesiak, M., et al. (2009) The mesenchymal stem cell

antigen MSCA-1 is identical to tissue non-specific alka-

line phosphatase. Stem Cells and Development, 19, 669-

677. doi:10.1089/scd.2009.0290

[14] Mornet, E., et al. (2001) Structural evidence for a func-

tional role of human tissue nonspecific alkaline phos-

phatase in bone mineralization. Journal of Biological Che-

mistry, 276, 31171-31178. doi:10.1074/jbc.M102788200

[15] O'Connor, M., et al. (2008) Alkaline phosphatase-posi-

tive colony formation is a sensitive, specific, and quanti-

tative indicator of undifferentiated human embryonic

stem cells. Stem Cells, 26, 1109-1116.

doi:10.1634/stemcells.2007-0801

[16] Adewumi, O. et al. (2007) Characterization of human

embryonic stem cell lines by the International Stem Cell

Initiative. Nature Biotechnology, 25, 803-816.

doi:10.1038/nbt1318

[17] Langer, D., Ikehara, Y., Takebayashi, H., Hawkes, R. and

Zimmermann, H. (2007) The ectonucleotidases alkaline

phosphatase and nucleoside triphosphate diphosphohy-

drolase 2 are associated with subsets of progenitor cell

populations in the mouse embryonic, postnatal and adult

neurogenic zones. Neuroscience, 150, 863-879.

doi:10.1016/j.neuroscience.2007.07.064

[18] Dellavalle, A., et al. (2007) Pericytes of human skeletal

muscle are myogenic precursors distinct from satellite

cells. Nature Cell Biology, 9, 255-267.

doi:10.1038/ncb1542

[19] Schwab, K. and Gargett, C. (2008) Co-expression of two

perivascular cell markers isolates mesenchymal stem-like

cells from human e ndometri um. Human Reproduction, 22,

2903-291 1. doi:10.1093/humrep/dem265

[20] Crisan, M., Corselli, M., Chen, C.W. and Péault, B. (2011)

Multilineage stem cells in the adult: A perivascular leg-

acy? Organogenesis, 7, 101-104.

A. M. de Aguiar et al. / Stem Cell Discovery 1 (2011) 71-80

doi:10.4161/org.7.2.16150

[21] Chen, Z., Evans, W., Pflugfelder, S. and Li, D. (2006)

Gap junction protein connexin 43 serves as a negative

marker for a stem cell-containing population of human

limbal epithelial cells. Stem Cells, 24, 1265-1273.

doi:10.1634/stemcells.2005-0363

[22] Yoon, B., et al. (2006) Enhanced differentiation of human

embryonic stem cells into cardiomyocytes by combining

hanging drop culture and 5-azacytidine treatment. Dif-

ferentiation, 74, 149-159.

doi:10.1111/j.1432-0436.2006.00063.x

[23] Schittini, A., et al. (2010) Human cardiac explant-con-

ditioned medium: Soluble factors and cardiomyogenic

effect on mesenchymal stem cells. Experimental Biology

and Medicine, 235, 1015-1024.

doi:10.1258/ebm.2010.010003

[24] Shigunov, P., et al. (2011) PUMILIO-2 I is involved in

the positive regulation of cellular proliferation in human

adipose-derived stem cells. Stem Cells and Development,

In Press. doi:10.1089/scd.2011.0143

[25] Rebelatto, C., et al. (2009) Expression of cardiac fu-

nction genes in adult stem cells is increased by treatment

with nitric oxide agents. Biochemical and Biophysical

Research Communications, 378, 45 6- 461 .

doi:10.1016/j.bbrc.2008.11.061

[26] Kelley, C., Blumberg, H., Zon, L.I. and Evans, T. (1993)

GATA-4 is a novel transcription factor expressed in en-

docardium of the developing heart. Development, 11 8,

817-827.

[27] Bearzi, C., et al. (2007) Human cardiac stem cells. Pro-

ceedings of the National Academy Science of the USA,

104, 14068-14073. doi:10.1073/pnas.0706760104

[28] Formiga, F., et al. (2010) Sustained release of VEGF

through PLGA microparticles improves vasculogenesis

and tissue remodeling in an acute myocardial ische-

mia-reperfusion mo del. Journal of Controlied Release, 147,

30-37. doi:10.1016/j.jconrel.2010.07.097

[29] Hierlihy, A., Seale, P., Lobe, C., Rudnicki, M. and Me-

geney, L. (2002) The post-natal heart contains a myo-

cardial stem cell population. FEBS Letters, 530, 239-243.

doi:10.1016/S0014-5793(02)03477-4

[30] Yamahara, K., et al. (2008) Heterogeneic nature of adult

cardiac side population cells. Biochemical and Biophysi-

cal Research Communications, 371, 615-620.

doi:10.1016/j.bbrc.2008.04.021

[31] Beltrami, A., et al. (2003) Adult cardiac stem cells are

multipotent and support myocardial regeneration. Cell,

114, 763-776. doi:10.1016/S0092-8674(03)00687-1

[32] Galvez, B., et al. (2008) Cardiac mesoangioblasts are

committed, self-renewable progenitors, associated with

small vessels of juvenile mouse ventricle. Cell Death and

Differentiation, 15, 1417-1428. doi:10.1038/cdd.2008.75

[33] Messina, E., et al. (2004) Isolation and expansion of ad-

ult cardiac stem cells from human and murine heart.

Circulation Research, 95, 911-921.

doi:10.1161/01.RES.0000147315.71699.51

[34] Gálvez, B., et al. (2009) Human cardiac mesoangio-

blasts isolated from hypertrophic cardio-myopathies are

greatly reduced in proliferation and differentiation po-

tency. Cardiovascular Research, 83, 707-716.

doi:10.1093/cvr/cvp159

[35] Bollini, S., Smart, N. and Riley, P. (2010) Resident car-

diac progenitor cells: At the heart of regeneration. Jour-

nal of Molecular and Cellular Cardiology, 50, 296-303.

doi:10.1016/j.yjmcc.2010.07.006

[36] Becerra, J., Santos-Ruiz, L., Andrades, J.A. and Marí-

Beffa, M. (2011) The stem cell niche should be a key is-

sue for cell therapy in regenerative medicine. Stem Cell

Reviews, 7, 248-255. doi:10.1007/s12015-010-9195-5

[37] Armiger, L.C., Fitzgerald, S., Vanderwee, M.A., Gavin,

J.B. and Herdson, P.B. (1981) The effects of altered ca-

tion balance on the fine structure of hypoxic myocardial

cells. Pathology, 13, 449-461.

doi:10.3109/00313028109059063

[38] Armiger, L.C., Seelye, R.N. , Morrison, M.A. and Holliss,

D.G. (1984) Comparative biochemistry and fine structure

of atrial and ventricular myocardium during autolysis in

vitro. Basic Research in Cardiology, 79, 218-229.

doi:10.1007/BF01908308

[39] Riekstina, U., et al. (2009) Embryonic stem cell marker

expression pattern in human mesenchymal stem cells de-

rived from bone marrow, adipose tissue, heart and dermis.

Stem Cell Reviews, 5, 378-386.

doi:10.1007/s12015-009-9094-9

[40] Lindner, H., et al. (1998) Loss of myocardial capillary

endothelial-cell alkaline phosphatase (ALP) activity in

primary endothelial cell culture. Cell and Tissue Re-

search, 291, 497-505. doi:10.1007/s004410051019

[41] Pasquinelli, G., et al. (2007) Thoracic aortas from multior-

gan donors are suitable for obtaining resident angiogenic

mesenchymal stromal cells. Stem Cells, 25 , 1627-1634.

doi:10.1634/stemcells.2006-0731