Journal of Cancer Therapy, 2014, 5, 67-73
Published Online January 2014 (http://www.scirp.org/journal/jct)
http://dx.doi.org/10.4236/jct.2014.51009
67
Evidence for Tumour Suppressor Function of DOK7 in
Human Breast Cancer
James Bracken1, Tamara Ghane m1, Abdul Kasem1, Wen G. Jiang2, Ke fah Mokbel1
1The London Breast Institute, The Princess Grace Hospital, London, UK; 2Metastasis and Angiogenesis Research Group, University
Department of Surgery, Cardiff University, Cardiff, UK.
Received November 25th, 2013; revised December 20th, 2013; accepted December 28th, 2013
Copyright © 2014 James Bracken et al. This is an open access article distributed under the Creative Commons Attribution License,
which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. In accor-
dance of the Creative Commons Attribution License all Copyrights © 2014 are reserved for SCIRP and the owner of the intellectual
property James Bracken et al. All Copyright © 2014 are guarded by law and by SCIRP as a guardian.
ABSTRACT
Introduction: Downstream of tyrosine kinase 7 (DOK-7) is a member of the DOK family, which has been associ-
ated with the development and progression of various humancancers. Previously, identification of CpG hyper-
methylation in DOK-7 promoter was identified in breast cancer. Method: DOK-7 mRNA extr actio n and revers e
transcription were performed on fresh frozen breast cancer tissue samples and normal background breast tissue.
Transcript levels of expression were analyzed against TNM stage, tumour grade and clinical outcome over a
10-year follow-up period. Results: Levels of DOK-7 expression decreased significantly with increasing TNM
stage. Higher DOK-7 expression was correlated with longer disease free and overall survival times. Conclusion:
To our knowledge, this is the first study to investigate DOK-7 expression in human breast cancer. We identify a
potential DOK-7 tumour suppressor role. DOK-7 as a prognostic biomarker in human breast cancer should be
included in future vali dati o n studi e s.
KEYWORDS
Breast Cancer; DOK-7; CpG Hypermethyl a tion; Tumour Suppressor; Prognostic Marker
1. Introduction
Identification of breast cancer biomarkers has shown
great promise in not only increasing prognostic ability
and molecular understanding at all stages of tumorigene-
sis but also aid in the decision of specific clinical inter-
ventions, potentially leading to the production of indi-
vidualized therapies [1-6]. Clinical impact has begun to
be achieved by several biomarkers most notably oestro-
gen receptor (ER) and human epidermal growth factor
receptor 2 ( HER2/ne u) [7].
The downstream of tyrosine kinase (DOK) family of
adaptor proteins consists of 7 members that share a struc-
tural topology characterized by an NH2-terminal pleck-
strin homology (PH) domain, a central phosphotyrosine-
binding (PTB) domain, followed by SH2 target motifs in
the carboxyl-terminal [8,9]. Several members of the
DOK family are associated with various human cancers;
recently DOK-2 has been suggested as a marker for poor
prognosis in gastric cancer [10,11]. Whilst two sub-
groups exist within the DOK family; DOK 1-3 primarily
expressed in haematopoietic tissues [12] and DOK 4-6
predominantly within the nervous system [13,14]; DOK-
7, expressed in skeletal muscle and the heart, plays a
distinct role in other members [15].
Mutations in DOK7 are a common cause of congenital
myasthenic syndrome (CMS). DOK-7 promotes trans-
autophosphorylation and activation of muscle-specific
kinase (MuSK) through formation of a dimeric structural
unit following PTB domain interaction with the phos-
phorylated juxtamembrane region of MuSK. Activation
of MuSK results in downstream induction of acetylcho-
line receptor (AChR) clustering on the post-synaptic
membrane, essential for efficient neuromuscular trans-
mission [15-20]. MuSK activation is also reliant on the
motor neuron-derived ligand Agrin and suggested phos-
phorylation of its intracellular domain by Casein Kinase
OPEN ACCESS JCT

Evidence for Tumour Suppressor Function of DOK7 in Human Breast Cancer
68
2 (CK2) [21,22]. Agrin has previously been linked as a
biomarker for colorectal and liver cancer [23] whilst
CK2 association with breast cancer is well established
through oncogene phosphorylation and over expression
correlating with metastatic risk [ 21 ,24].
In a recent methylation profiling study of twins dis-
cordant for breast cancer, Heyn et al., identified hyper-
methylation of the DOK-7 gene in primary breast cancer
tissues, cell lines and whole blood samples [25]. CpG site
hypermethylation was observed within the DOK-7 pro-
moter region. Recently, the importance of epigenetic mo-
difications in cancer development and progression has
been well-established [26-28]. In breast cancer, CpG
island hypermethylation is associated with down regula-
tion of various tumour suppressor genes, controlling all
aspects of cellular function [3,29]. One way down regu-
lation is thought to be that result is via abrogation of
transcription factor binding to methylated promoter re-
gions. The Sp1 transcription factor has been demon-
strated to activate DOK-7 expression [30]. Sp1 has been
found to participate in the expression of several onco-
genes and up-regulation of its own expression has been
observed in a percentage of breast tumours [31-37].
In view of the association between DOK-7 hyper-
methylation and breast cancer, we examined the expres-
sion profile of DOK-7 in a cohort of archival normal and
breast cancer specimens. Transcript levels were evalu-
ated against established pathological and prognostic pa-
rameters in addition to clinical outcome.
2. Method
2.1. Patients and Samples
Institutional guidelines, including ethical approval and
informed consent were followed. Primary breast cancer
tissues (n = 112) and adjacent non-cancerous mammary
tissue (n = 31) were collected immediately after surgical
excision and stored at −80˚C. An independent specialist
pathologist examined haematoxylin and eosin stained
frozen sections to verify the presence of tumour cells in
the collected samples. Where normal non-neoplastic tis-
sues were used, no tumour cells were found in the sec-
tions. All tissues were randomly numbered and the de-
tails were only made known after all analyses were com-
pleted.
All patients were tre ated according to local algorithms
of management following a multidisciplinary discussion.
Patients treated with breast-conserving surgery received
adjuvant radiotherapy. Those with hormone-sensitive
malignancy received tamoxifen. Fit patients with node-
positive breast cancer or hormone-insensitive large and/
or high-grade cancer were offered adjuvant chemother-
apy. Medical notes and histology reports were used to
extract clinico-patholog ical data (Table 1) [38].
2.2. Materials
RNA extraction kits and reverse transcription kits were
obtained from Sigma-Aldrich Ltd (Poole, Dorset, Eng-
land, UK). The PCR primers were designed using Bea-
con Designer (Palo Alto, CA, USA) and synthesized by
Sigma-Aldrich. Custom made hot-start Master Mix for
quantitative Polymerase Chain Reaction (PCR) was ob-
tained from Abgene (Surrey , England, U K) [38-40].
2.3. Tissue Processing, RNA Extraction and
cDNA Synthesis
Frozen sections of tissue were cut at a thickness of 5 - 10
μm and kept for routine histological analysis. Additional
15 - 20 sections were mixed and homogenized using a
hand-held homogenizer in ice-cold RNA extraction solu-
tion. The concentration of RNA was determined using
UV spectrophotometry. Reverse transcription was carried
Table 1. Clinical and pathological data.
Parameter Category Nu mb e r
Node status Positive 54
Negative 73
Tumour grade 1 24
2 43
3 58
Tumour type Ductal 98
Lobular 14
Medullary 2
Tubular 2
Mucinous 4
Other 7
TNM staging 1 70
2 40
3 7
4 4
NPI NPI1 68
NPI2 38
NPI3 16
Clinical outcome Disease-free 90
With local recurrence 5
Alive with metastasis 7
Died of breast cancer 16
Note: missing values reflect discarded/un-interpretable values.
OPEN ACCESS JCT

Evidence for Tumour Suppressor Function of DOK7 in Human Breast Cancer
69
out using a reverse transcription kit with an anchored
oligo (dT) primer supp lied by Ab gen e, using 1 μg of total
RNA in a 96-well plate. The quality of cDNA was veri-
fied usin g Cytokeratin 19 (CK19) primers (Table 2) [38].
2.4. Quantitative Analysis
The level of DOK-7 transcripts from the above prepared
DNA was determined using real-time quantitative PCR
based on the Amplifluor technology, modified from a
method reported previously [38,41]. The PCR primers
were designed using Beacon Designer software, but to
the reverse primer an additional sequence known as a Z
sequence (5’-ACTGAACCTGACCGTACA-3’) which is
complementary to the universal Z probe (Intergen Inc.,
Oxford, UK) was added. The product expands one intron.
The primers used are detailed in Table 2. The reaction
was carried out using Hotstart Q-master mix (Abgene),
10 pmol of specific forward primer, 1 pmol reverse pri-
mer which had the Z sequence, 10 pmol of FAM (fluoro-
genic reporter dye, carboxyfluorescein) tagged probe
(Intergen Inc.), and cDNA from 50 ng of RNA. The re-
action was carried out using the IcyclerIQ (Bio-Rad Ltd,
Hemel Hempstead, England, UK), which is equipped
with an optic unit that allows real-time detection of 96
reactions, under the following conditions: 94˚C for 12
min and 50 cycles of 94˚C for 15 sec, 55˚C for 40 sec,
and 72˚C for 20 sec. The levels of the transcript were
generated from a standard that was simultaneously am-
plified with the samples. The levels of gene expression
were then normalized against the housekeeping gene
CK19, which was already quantified in these specimens,
to correct for varying amounts of epithelial tissue be-
tween samples [42]. The primers used for CK19 are de-
tailed in Tab l e 2 . With every PCR run, a negative control
without a template and a known cDNA reference sample
as a positi ve c o nt rol, were i nc luded.
2.5. Statistical Analysis
The Mann-Whitney U-test and two-sample t-test were
used for statistical analysis of absolute and normalised
gene copy number. The transcript levels within the breast
cancer specimens were compared to normal background
Table 2. DOK-7 and CK19 Primers.
DOK-7
Forward gagtaggtggctggtgct
Z Reverse actgaacctgaccgtacacagatgtcctctagcgtca
CK19
Forward caggtccgaggttactgac
Reverse actgaacctgaccgtacacactttctgccagtgtgtcttc
tissues and analyzed against conventional pathological
parameters and clinical outcome over a 10 year follow-
up period. The statistical analysis was carried out using
Minitab version 14.1 (Minitab Ltd. Coventry, England,
U.K.) using a custom written macro (Stat 2005. mtw).
For purposes of the Kaplan-Meier survival analysis, the
samples were divided arbitrarily into two groups, “high
transcript level” or “low transcript level”, for the DOK-7
gene. The cut-off was guided by the Nottingham Prog-
nostic Index (NPI) value, with which the value of the
moderate prognostic group was used as the dividing line
at the start of the test. Disease Free Survival (DFS) and
Overall Survival (OS) analyses were performed using
SPSS version 12.0.1 (SPSS Inc. Chicago, IL, USA). For
multivariate analysis using the Cox regression model,
PASW Statistics 18 Software (Chicago, IL, USA) was
used.
3. Results
DOK-7 expression profile was determined via quantita-
tive PCR in both absolute terms and normalized against
CK19. DOK-7 was found to be expressed in both nor-
mal/benign breast tissue and breast cancer specimens.
Overall, no difference was found between DOK-7 ex-
pression in breast cancer specimens and its expression in
normal background tissue.
The expression of DOK-7 mRNA was demonstrated to
significantly decrease with increasing TNM class; TNM-
1 vs. TNM-4 [mean copy number 21,895 vs. 1239, 95%
CI (3787, 37,526), p = 0.02] and TNM-2 vs. TNM-4
[mean copy number 7982 vs. 1239, 95% CI (−58,
13,544), p = 0.05]. DOK-7 expression in TNM-4 speci-
mens was also significantly lower than normal breast
samples [mean copy number 1239 vs. 39,810, 95% CI
(−75,665, −1478), p = 0.04] (Table 3).
A noticeable trend in decreasing DOK-7 expression
with increasing Nottingham Prognostic Index (NPI) was
observed; however, this did not reach statistical signifi-
cance (NPI-3 compared to NPI-1 and NPI-2, p = 0.08
and p = 0.16, respectively). Transcript levels were sig-
nificantly lower in Grade-1 tumour specimens than
Grade-2 [mean copy number 752 vs. 32,796, 95% CI
(−58,069, −6019), p = 0.02] although no overall trend
existed amongst tumour grades (Table 3).
After a median follow up of 10 years, DOK-7 mRNA
expression levels were significantly higher in women that
remained disease free compared to those who developed
local recurrence [mean copy number 21,675 vs. 2310,
95% CI (3134, 35 ,596), p = 0.02] or those that died from
breast cancer [mean copy number 216,75 vs. 1835, 95%
CI (3790, 35,890), p = 0.02]. Furthermore, expression
levels of women who developed lo cal recurrence or died
from breast cancer were significantly lower than normal
breast samples [mean copy number 2310 vs. 39,810, 95%
OPEN ACCESS JCT

Evidence for Tumour Suppressor Function of DOK7 in Human Breast Cancer
70
Table 3. DOK-7 mean mRNA expression level.
Patient and tumour
Characteristics DOK-7 mean (SD) p
NPI
NPI 1 vs. 2 23538 (81191) vs. 20632 (67371) 0.85
NPI 1 vs. 3 23538 (81191) vs. 4267 (8882) 0.08
NPI 2 vs. 3 20632 (67371) vs. 4267 (8882) 0.16
Tumour Grade
Grade 1 vs. 2 752 (1584) vs. 32796 (80234) 0.02
Grade 1 vs. 3 752 (1584) vs. 14742 (72914) 0.17
Grade 2 vs. 3 32796 (80234) vs. 14742 (72914) 0.27
TNM
TNM 1 vs. 2 21895 (65670) vs. 7982 (20072) 0.13
TNM 1 vs. 3 21895 (65670) vs. 79286 (199804) 0.48
TNM 1 vs. 4 21895 (65670) vs. 1239 (1253) 0.02
TNM 2 vs. 3 7982 (20072) vs. 79286 (199804) 0.38
TNM 2 vs. 4 7982 (20072) vs. 1239 (1253) 0.05
TNM 3 vs. 4 79286 (199804) vs. 1239 (1253) 0.34
Survival
DF vs. LR 21675 (70979) vs. 2310 (5029) 0.02
DF vs. DR 21675 (70979) vs. 80140 (173108) 0.49
DF vs. D 21675 (70979) vs. 1835 (5438) 0.02
CI (−74,775, −226), p = 0.05] and [mean copy number
1835 vs. 39,810, 95% CI (−75,165, −785), p = 0.05],
respectively (Table 3).
There is a trend for specimens with lower levels of
DOK-7 expression to associate with shorter disease-free
(DFS) and overall survival (OS) times. Survival curves
(DFS and OS) for women with tumours expressing “high
levels” of DOK-7 differed significantly from those clas-
sified as having “low levels”. The survival curves show
higher levels of DOK-7 were of significant benefit in
predicting higher DFS (p = 0.006) and better OS (p =
0.009) (Figures 1 and 2).
4. Discussion
Here we present the mRNA expression profile of DOK-7
in breast cancer specimens and demonstrate decreased
expression levels with increasing pathological and prog-
nostic statuses.
We have observed a significant decrease in DOK-7
Figure 1. Kaplan Meier Di se ase Fr ee Sur vi va l (DSF) Cur ve s
for DOK-7. Survival times are expressed as mean number
of months with 95% confidence interval. DFS (p = 0.006).
Figure 2. Kaplan Meier Overall Survival (OS) Curves for
DOK-7. Survival times are expressed as mean number of
months with 95% confidence interval. OS (p = 0.009).
expression level with increasing TNM stage, raising the
potential for a novel tumour suppressor function outside
its essential role in neuromuscular synaptogenesis. In
addition, DOK-7 expression in TNM-4 stage tumours
was significantly lower than that of normal breast tissue.
Prior to this study, Heyn et al. detailed hyper-methyla-
tion of a CpG site within the DOK-7 promoter in twins
discordant for breast cancer [25]. CpG promoter hyper-
methylation is associated with down regulation of gene
expression, concurrent with our results. The scale of epi-
genetic modifications associated with tumour develop-
ment and progression is beginning to be appreciated with
particular efforts placed in the identification of methyla-
tion signatures that could serve as prognostic/predictive
markers in breast cancer [7,27].
OPEN ACCESS JCT

Evidence for Tumour Suppressor Function of DOK7 in Human Breast Cancer
71
Other members of the DOK family of adaptor proteins
have been identified to possess tumour suppressor roles;
none more so than DOK-1, which is down regulated in
several human cancers as a result of hyper-methylation
of its promoter region [43]. Whilst other members of the
DOK family modulate proliferative signalling pathways,
DOK-7 is currently seen to have a distinct expression
pattern and role in MuSK activation to promote AChR
clustering [16], making it difficult to posit the nature of
any potential DOK-7 tumour suppressor function. How-
ever, several proteins employed in the Agrin/MuSK
pathway that harbour additional roles, such as Ck2, have
been associated with human breast cancer [21,22,44].
Moreover, one mechanism by which methylation can
down-regulate expression, is by blocking transcription
factors from accessing target-binding sites within the
promoter region. Amongst its broad spectrum, Sp1 tran-
scriptionally activates DOK-7 and is up-regulated in a
percentage of breast cancers [30,45].
Furthermore, our results demonstrated significantly
lower DOK-7 expression levels in women who devel-
oped local recurrence or died from breast cancer follow-
ing a median 10-year follow up period compared to both
normal breast tissue and women that remained disease
free over the same period of time. Disease free survival
(DFS) and overall survival (OS) curves revealed that a
higher DOK-7 expression level was a significant predic-
tor of superior DFS and OS, supporting the suitability of
DOK-7 as a prognostic biomarker for breast cancer. Bio-
marker prediction of recurrence after curative resection is
useful for determining intensity of clinical surveillance
and adjuvant therapies.
Limitations of the present study included the use of
background parenchyma from breast cancer patients to
provide “normal tissue” for comparison. Ideally, such
material should be derived from patients without breast
cancer in order to avoid any “field change” that may ex-
ist within cancer bearing tissues. Although the follow-up
period was substantial, sample size was relatively small
and it is possible that a larger cohort may have influ-
enced several results that approached, but failed to reach,
statistical significance. Furthermore, the protein expres-
sion and epigenetic modifications were not analysed in
the present study and should be included in future inves-
tigations.
5. Conclusion
To our knowledge, this is the first study to investigate
DOK-7 expression in human breast cancer and identify a
potential tumour suppressor role. We also present data to
support the value of DOK-7 as a prognostic biomarker in
breast cancer. Restoring or mimicking the function of
DOK-7 could provide a novel therapeutic modality
against cancer.
REFERENCES
[1] S. Mehta, et al., “Predictive and Prognostic Molecular
Markers for Cancer Medicine,” Therapeutic Advances in
Medical Oncology, Vol. 2, No. 2, 2010, pp. 125-148.
http://dx.doi.org/10.1177/1758834009360519
[2] A. W. Opstal-van Winden, et al., “Searching for Early
Breast Cancer Biomarkers by Serum Protein Profiling of
Pre-Diagnostic Serum; a Nested Case-Control Study,”
BMC Cancer, Vol. 11, 2011, p. 381.
http://dx.doi.org/10.1186/1471-2407-11-381
[3] S. Y. Park, et al., “Promoter CpG Island Hypermethyla-
tion during Breast Cancer Progression,” Virchows Arch,
Vol. 458, No. 1, 2011, pp. 73-84.
http://dx.doi.org/10.1007/s00428-010-1013-6
[4] P. Taneja, et al., “Classical and Novel Prognostic Markers
for Breast Cancer and their Clinical Significance,” Clini-
cal Medicine Insights: Oncology, Vol. 4, 2010, pp. 15-34.
[5] M. T. Weigel and M. Dowsett, “Current and Emerging
Biomarkers in Breast Cancer: Prognosis and Prediction,”
Endocrine-Related Cancer, Vol. 17, No. 4, 2010, pp.
R245-R262. http://dx.doi.org/10.1677/ERC-10-0136
[6] F. Zhang, et al., “Recursive SVM Biomarker Selection
for Early Detection of Breast Cancer in Peripheral Blood,”
BMC Medical Genomics, Vol. 6, Suppl. 1, 2013, p. S4.
http://dx.doi.org/10.1186/1755-8794-6-S1-S4
[7] K. D. Cole, H. J. He and L. Wang, “Breast Cancer Bio-
marker Measurements and Standards,” PROTEOMICS-
Clinical Applications, Vol. 7, No. 1-2, 2013, pp. 17-29.
http://dx.doi.org/10.1002/prca.201200075
[8] A. Bedirian, et al., “Pleckstrin Homology and Phospho-
tyrosine-Binding Domain-Dependent Membrane Asso-
ciation and Tyrosine Phosphorylation of Dok-4, an In-
hibitory Adapter Molecule Expressed in Epithelial Cells,”
Journal of Biological Chemistry, Vol. 279, 2004, pp.
19335-19349. http://dx.doi.org/10.1074/jbc.M310689200
[9] A. H. Berger, et al., “Identification of DOK Genes as
Lung Tumor Suppressors,” Nature Genetics, Vol. 42,
2010, pp. 216-223. http://dx.doi.org/10.1038/ng.527
[10] C. H. An, et al., “Mutational and Expressional Analysis
of a Haploinsufficient Tumor Suppressor Gene DOK2 in
Gastric and Colorectal Cancers,” APMIS, Vol. 119, No. 8,
2011, pp. 562-564.
http://dx.doi.org/10.1111/j.1600-0463.2011.02749.x
[11] H. Miyagaki, et al., “DOK2 as a Marker of Poor Progno-
sis of Patients with Gastric Adenocarcinoma after Cura-
tive Resection,” Annals of Surgical Oncology, Vol. 19,
No. 5, 2012, pp. 1560-1567.
http://dx.doi.org/10.1245/s10434-011-2157-6
[12] R. Mashima, et al., “Mice Lacking Dok-1, Dok-2, and
Dok-3 Succumb to Aggressive Histiocytic Sarcoma,”
Laboratory Investigation, Vol. 90, 2010, pp. 1357-1364.
http://dx.doi.org/10.1038/labinvest.2010.121
[13] R. J. Crowder, et al., “Dok-6, a Novel p62 Dok Family
Member, Promotes Ret -Mediated Neurite Outgrowth,”
Journal of Biological Chemistry, Vol. 279, 2004, pp.
42072-42081. http://dx.doi.org/10.1074/jbc.M403726200
[14] J. Grimm, et al., “Novel p62dok Family Members, dok-4
and dok-5, Are Substrate s of the c-Ret Receptor Ty rosine
OPEN ACCESS JCT

Evidence for Tumour Suppressor Function of DOK7 in Human Breast Cancer
72
Kinase and Mediate Neuronal Differentiation,” Journal of
Cell Biology, Vol. 154, No. 2, 2001, pp. 345-354.
http://dx.doi.org/10.1083/jcb.200102032
[15] J. Cossins, et al., “The Spectrum of Mutations That Un-
derlie the Neuromuscular Junction Synaptopathy in DOK7
Congenital Myasthenic Syndrome,” Human Molecular
Genetics, Vol. 21, No. 17, 2012, pp. 3765-3775.
http://dx.doi.org/10.1093/hmg/dds198
[16] E. Bergamin, et al., “The Cytoplasmic Adaptor Protein
Dok7 Activates the Receptor Tyrosine Kinase MuSK via
Dimerization,” Molecular Cell, Vol. 39, No. 1, 2010, pp.
100-109. http://dx.doi.org/10.1016/j.molcel.2010.06.007
[17] A. Inoue, et al., “Dok-7 Activates the Muscle Receptor
Kinase MuSK and Shapes Synapse Formation,” Science
Signaling, Vol. 2, No. 59, 2009, p. ra7.
http://dx.doi.org/10.1126/scisignal.2000113
[18] A. Klein, et al., “DOK7 Congenital Myasthenic Syn-
drome in Childhood: Early Diagnostic Clues in 23 Chil-
dren,” Neuromuscular Disorders, Vol. 23, No. 11, 2013,
pp. 883-891. http://dx.doi.org/10.1016/j.nmd.2013.06.002
[19] J. S. Muller, et al., “Phenotypical Spectrum of DOK7
Mutations in Congenital Myasthenic Syndromes,” Brain,
Vol. 130, No. 6, 2007, pp. 1497-1506.
http://dx.doi.org/10.1093/brain/awm068
[20] K. Okada, et al., “The Muscle Protein Dok-7 Is Essential
for Neuromuscular Synaptogenesis,” Science, Vol. 312,
No. 5781, 2006, pp. 1802-1805.
http://dx.doi.org/10.1126/science.1127142
[21] T. Cheusova, et al., “Casein Kinase 2-Dependent Serine
Phosphorylation of MuSK Regulates Acetylcholine Re-
ceptor Aggregation at the Neuromuscular Junction,”
Genes & Development, Vol. 20, 2006, pp. 1800-1816.
http://dx.doi.org/10.1101/gad.375206
[22] D. J. Glass, et al., “Agrin Acts via a MuSK Receptor
Complex,” Cell, Vol. 85, No. 4, 1996, pp. 513-523.
http://dx.doi.org/10.1016/S0092-8674(00)81252-0
[23] S. Klein-Scory, et al., “Immunoscreening of the Extracel-
lular Proteome of Colorectal Cancer Cells,” BMC Cancer,
Vol. 10, 2010, p. 70.
http://dx.doi.org/10.1186/1471-2407-10-70
[24] D. Drygin, et al., “Protein Kinase CK2 Modulates IL-6
Expression in Inflammatory Breast Cancer,” Biochemical
and Biophysical Research Communications, Vol. 415, No.
1, 2011, pp. 163-167.
http://dx.doi.org/10.1016/j.bbrc.2011.10.046
[25] H. Heyn, et al., “DNA Methylation Profiling in Breast
Cancer Discordant Identical Twins Identifies DOK7 as
Novel Epigenetic Biomarker,” Carcinogenesis, Vol. 34,
No. 1, 2013, pp. 102-108.
http://dx.doi.org/10.1093/carcin/bgs321
[26] M. Esteller, “Epigenetics in Cancer,” New England Jour-
nal of Medicine, Vol. 358, 2008, pp. 1148-1159.
http://dx.doi.org/10.1056/NEJMra072067
[27] Y. Huang, et al., “Epigenetics in Breast Cancer: What’s
New?” Breast Cancer Research, Vol. 13, 2011, p. 225.
http://dx.doi.org/10.1186/bcr2925
[28] S. Sharma, T. K. Kelly and P. A. Jones, “Epigenetics in
Cancer,” Carcinogenesis, Vol. 31, No. 1, 2010, pp. 27-36.
http://dx.doi.org/10.1093/carcin/bgp220
[29] J. F. Costello, et al., “Aberrant CpG-Island Methylation
Has Non-Random and Tumour-Type-Specific Patterns,”
Nature Genetics, Vol. 24, 2000, pp. 132-138.
http://dx.doi.org/10.1038/72785
[30] J. Hamuro, et al., “The Transcription Factor Sp1 Plays a
Crucial Role in dok-7 Gene Expression,” Biochemical
and Biophysical Research Communications, Vol. 408, No.
2, 2011, pp. 293-299.
http://dx.doi.org/10.1016/j.bbrc.2011.04.020
[31] S. Lu and M. C. Archer, “Sp1 Coordinately Regulates de
Novo Lipogenesis and Proliferation in Cancer Cells,” In-
ternational Journal of Cancer, Vol. 126, No . 2, 2010, pp.
416-425. http://dx.doi.org/10.1002/ijc.24761
[32] S. U. Mertens-Talcott, et al., “Betulinic Acid Decreases
ER-Negative Breast Cancer Cell Growth in Vitro and in
Vivo: Role of Sp Transcription Factors and microRNA-
27a:ZBTB10,” Molecular Carcinogenesis, Vol. 52, No. 8,
2013, pp. 591-602. http://dx.doi.org/10.1002/mc.21893
[33] X. B. Wang, et al., “Expression and Prognostic Value of
Transcriptional Factor sp1 in Breast Cancer,” Chinese
Journal of Cancer, Vol. 26, No. 9, 2007, pp. 996-1000.
[34] M. Wei, et al., “Stat6 Cooperates with Sp1 in Controlling
Breast Cancer Cell Proliferation by Modulating the Ex-
pression of p21 (Cip1/WAF1) and p27 (Kip1),” Cellular
Oncology, Vol. 36, No. 1, 2013, pp. 79-93.
http://dx.doi.org/10.1007/s13402-012-0115-3
[35] X. Yang, et al., “HSF1 and Sp1 Are Involved in the
Regulation of FUT4 Gene Expression and Cell Prolifera-
tion in Breast Cancer Cells,” Journal of Cellular Bio-
chemistry, Vol . 115, No . 1 , 2014, pp. 168-178.
[36] L. Yue, et al., “The Oncoprotein HBXIP Activates Tran-
scriptional Coregulatory Protein LMO4 via Sp1 to Pro-
mote Proliferation of Breast Cancer Cells,” Carcinogene-
sis, Vol. 34, No. 4, 2013, pp. 927-935.
http://dx.doi.org/10.1093/carcin/bgs399
[37] Y. Zhang, et al., “The Oncoprotein HBXIP Upregulates
PDGFB via Activating Transcription Factor Sp1 to Pr o-
mote the Proliferation of Breast Cancer Cells,” Bio-
chemical and Biophysical Research Communications,
Vol. 434, No. 2, 2013, pp. 305-310.
http://dx.doi.org/10.1016/j.bbrc.2013.02.123
[38] W. Sasi, et al., “Higher Expression Levels of SOCS
1,3,4,7 Are Associated with Earlier Tumour Stage and
Better Clinical Outcome in Human Breast Cancer,” BMC
Cancer, Vol. 10, 2010, p. 178.
http://dx.doi.org/10.1186/1471-2407-10-178
[39] W. Al Sarakbi, et al., “The mRNA Expression of SETD2
in Human Breast Cancer: Correlation with Clinico-
Pathological Parameters,” BMC Cancer, Vol. 9, 2009, p.
290. http://dx.doi.org/10.1186/1471-2407-9-290
[40] W. G. Jiang, et al ., “Prognostic Value of rho GTPases and
rho Guanine Nucleotide Dissociation Inhibitors in Human
Breast Cancers,” Clinical Cancer Research, Vol. 9, No.
17, 2003, pp. 6432-6440.
[41] T. Nakagawa, et al., “Decreased Expression of SOCS-3
mRNA in Breast Cancer with Lymph Node Metastasis,”
Oncology Reports, Vol. 19, No. 1, 2008, pp. 33-39.
OPEN ACCESS JCT

Evidence for Tumour Suppressor Function of DOK7 in Human Breast Cancer
73
[42] Z. Dogusan, et al., “Expression of SOCS Genes in Nor-
mal and Leukemic Human Leukocytes Stimulated by
Prolactin, Growth Hormone and Cytokines,” Journal of
Neuroimmunology, Vol. 109, No. 1, 2000, pp. 34-39.
http://dx.doi.org/10.1016/S0165-5728(00)00300-3
[43] A. Saulnier, et al., “Inactivation of the Putative Suppres-
sor Gene DOK1 by Promoter Hypermethylation in Pri-
mary Human Cancers,” International Journal of Cancer,
Vol. 130, No. 11, 2012, pp. 2484-2494.
http://dx.doi.org/10.1002/ijc.26299
[44] A. Ben Ammar, et al., “A Mutation Causes MuSK Re-
duced Sensitivity to Agrin and Congenital Myasthenia,”
PLoS One, Vol. 8, 2013, Article ID: e53826.
http://dx.doi.org/10.1371/annotation/3ff2b918-c83c-4c 6f-
a2e2-4d91294ec92f
[45] W. C. Chang and J. J. Hung, “Functional Role of Post-
Translational Modifications of Sp1 in Tumorigenesis,”
Journal of Biomedical Science, Vol. 19, 2012, p. 94.
http://dx.doi.org/10.1186/1423-0127-19-94
Abbreviations
NPI: Nott i ng ham Prog nostic Index
DF: Disease Free
LR: Local Reoccurrence
DR: Distant Reoccurrenc e
TNM: TNM Classification of Malignant Tumours
OPEN ACCESS JCT