Advances in Infectious Diseases, 2013, 3, 290-294
Published Online December 2013 (http://www.scirp.org/journal/aid)
http://dx.doi.org/10.4236/aid.2013.34044
Open Access AID
Detection of 16S rRNA Methylase Genes in Gram-Negative
Bacilli Isolated from Hospitals in Changchun, China
Fan Zhao1, Hongyan Shi2, Jinghua Li2, Jiaqi Zhou2, Yanbo Sun2*
1Department of Orthopedics, China-Japan Union Hospital of Jilin University, Changchun, China; 2Department of Pathogen Biology,
Basic Medical College of Jilin University, Changchun, China.
Received November 4th, 2013; revised December 3rd, 2013; accepted December 10th, 2013
Copyright © 2013 Fan Zhao et al. This is an open access article distributed under the Creative Commons Attribution License, which
permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
ABSTRACT
Methylation of 16S rRNA is an important mechanism of aminoglycoside resistance among gram-negative pathogens. In
this report, 16S rRNA methylase genes were amplified using PCR among gram-negative bacillus isolates from hospitals
in the Changchun area of China and 16S rRNA methylase genotypes (armA, rmtB, rmtA, rmtC, rmtD, and npmA) were
identified by direct sequencing. Fifty of the isolates (43.1%) harbored 16S rRNA methylase genes. The common 16S
rRNA methylase genes were armA and rmtB (12.1% and 31.0%, respectively), whereas the rmtA, rmtC, rmtD, and
npmA genes were absent from the sample. It suggests that the predominant 16S rRNA methylase genes among gram-
negative bacilli in the Changchun area are armA and rmtB.
Keywords: 16S rRNA; Methylases; Gram-Negative Bacilli
1. Introduction
Aminoglycosides have strong antibacterial activity against
gram-negative bacilli and gram-positive bacilli. Amino-
glycosides are well received by clinicians because of
their broad antimicrobial spectrum and efficacy. The irra-
tional use of antibiotics is causing increasingly acute pro-
blems associated with antimicrobial resistance, however.
The methylation of 16S rRNAs in gram-negative bacilli
is one of the mechanisms underlying strong resistance to
aminoglycosides. Recent studies [1-2] showed that 16S
rRNA methylase could methylate the 30S ribosomal sub-
unit in gram-negative bacilli. 16S rRNA methylase can
protect the target sites of the 30S ribosomal subunit, pre-
venting the aminoglycosides from combining with the
30S ribosomal subunit.
Following the first discovery of 16S rRNA methylase
gene armA in France [3], other methylases such as rmtB,
rmtA, and rmtC were found among gram-negative patho-
gens [4,5]. The predominant methylase genes in southern
China are armA and armB [6]; however, the prevalence
of 16S rRNA methylases among clinical isolates of gram-
negative bacilli in Changchun, Northeast of China, has
not been previously assessed. 16S rRNA methylase me-
diates high-level resistance to aminoglycosides in gram-
negative isolates, and some spices in gram-negative ba-
cilli are major causes of nosocomial infections [7]. The
aim of this study was to investigate the prevalence of 16S
rRNA methylases in aminoglycoside-resistant isolating
from three hospitals in Changchun and to characterize
the host bacteria.
2. Materials and Methods
2.1. Isolates and Drugs
One hundred and sixteen strains of gram-negative bacilli
were isolated from China-Japan Union Hospital of Jilin
University (Changchun, China), the Affiliated Hospital to
Changchun University of Chinese Medicine (Changchun,
China), and the Clinical Laboratory of Jilin Province
People’s Hospital (Changchun, China). The clinical iso-
lates consisted of 33 Escherichia coli strains, 25 Klebsi-
ella pneumoniae strains, 14 Enterobacter cloacae strains,
15 Acinetobacter baumannii strains, 19 Pseudomona s ae-
ruginosa strains, and 10 Serratia marcescens strains. Iden-
tification of these isolates was done using the VITEK-32
system (Mérieux, France). Amikacin was provided by the
National Institute for the Control of Pharmaceutical and
Biological Products (batch number 130335-200204) (Bei-
*Corresponding author.

Detection of 16S rRNA Methylase Genes in Gram-Negative Bacilli Isolated from Hospitals in Changchun, China 291
jing, China). Gentamicin was supplied by Beijing Ding-
guo Changsheng Biotech Co., Ltd. (batch number
1B310330) (Beijing, China).
2.2. Testing for Antibiotic Susceptibility by Agar
Dilution
The susceptibilities of the 116 strains to amikacin and
gentamicin were determined by agar dilution. Isolates
that were able to grow at antibiotic concentrations above
16 mg/L were regarded as being resistant to the antibiot-
ics; and those that were not able to grow at concentra-
tions above 2 mg/L were regarded as sensitive.
2.3. Extraction of Bacteria DNA
One milliliter of bacterial culture was placed in a 1.5 mL
centrifuge tube and centrifuged at 10,000 rpm for 1 min.
The supernatant was removed, and 100 μL TE Buffer (1
mol/L Tris-HCl, pH 8.0; 500 mmol/L EDTA, pH8.0) was
added. Then, an equal volume of mixed phenol, chloro-
form, and isoamyl alcohol (25:24:1) was added. Vortex os-
cillation was then performed for 30 s, and the mixture
was subsequently centrifuged at 10,000 rpm for 5 min.
The resulting supernatant was then stored at −20˚C until
later use as the template for genetic testing.
2.4. Primer Design and Detection of 16S rRNA
Methylase Genes
Primers were self-designed for six different 16S rRNA
methylase gene sequences available from GenBank. The
primer sequences, target genes, and primer lengths are
shown in Table 1. The conditions for producing PCR
products with lengths greater than 500 bp were: 2 min at
93˚C; 35 cycles of 1 min at 93˚C, 1 min at 55˚C, and 1
min at 72˚C; followed by 5 min at 72˚C. The conditions
for producing PCR products with lengths less than 500
bp were: 5 min at 93˚C; 35 cycles of 30 s at 93˚C, 30 s at
55˚C, and 1 min at 72˚C; followed by 5 min at 72˚C. Af-
ter 2% agarose gel electrophoresis, the PCR products
were observed under a gel imager and photos were taken.
2.5. PCR Product Sequencing
The PCR products were sent to Beijing Genomics Insti-
tute, (Beijing, China) for sequencing. The sequences were
detected using the Chromas software and compared with
those released by GenBank.
3. Results
3.1. Results of Antibiotic Susceptibility Testing
Among the 116 gram-negative bacilli, 16 E. coli strains,
1 K. pneumoniae strain, 3 E. cloacae strains, 11 A. bau-
mannii strains, 10 P. aeruginosa strains, and 9 S. marces-
Table 1. Primer sequences for the six known 16S rRNA me-
thylase genotypes.
Target
gene Primer sequences (5’ → 3’) Product length (bp)
armAP1: ATGGAT AAGAATGATGTTGTTAAG
P2: TTAT T TCTGAAATCCACTAGT AATTA774
rmtAP1: ACTGTGATGGGATACGCGTC
P2:AGCGATATCCAACACACGATGG 315
rmtBP1: ATGAACATCAACGATGCCCTC
P2:TTATCCATTCTTTTTTATCAAGTATAT 756
rmtCP1: ATGAAAACCAACGATAATTATC
P2:TTACAATCTCGATACGATAAAATAC 846
rmtDP1:ATGAGCGAACTGAAGGAAAAACTGCT
P2:TCATTTTCGTTTCAGCACGTAAAACAG 744
npmAP1:TTGGGTACTGGAGACGGTAG
P2: CAGCT TTGTATTGT TCGCTC 421
cens strains showed resistance to amikacin concentra-
tions exceeding 16 mg/L (Ta b l e 2). Likewise, 26 E. coli
strains, 11 K. pneumoniae strains, 8 E. cloacae strains, 15
A. baumannii strains, 17 P. aeruginosa strains, and 10 S.
marcescens strains exhibited resistance to gentamycin con-
centrations exceeding 16 mg /L (Table 3).
3.2. Results of 16S rRNA Methylase Genetic
Testing
Fifty (43.1%) of the 116 isolates harbored 16S rRNA me-
thylase genes. The common 16S rRNA methylase genes
were armA (12.1%, 14/116) and rmtB (31.0%, 36/ 116).
All of the isolates were negative for the rmtA, rmtC,
rmtD, and npmA genotypes (Table 4). Additionally, three
of the S. marcescens strains harbored both armA and
rmtB and were highly resistant to both amikacin and gen-
tamicin. An electrophoregram of the products of PCR
amplification of armA and rmtB is shown in Figures 1
and 2.
3.3. Sequencing of 16S rRNA Methylase
The results of the direct sequencing of the armA and rmtB
genes isolated from our sample were compared with the
corresponding sequences in the GenBank database, and
the sequences in our sample were found to be identical to
those in the database (arm A:HQ204573.1; rmt
B:FJ539137.1).
4. Discussion
Aminoglycosides exert their antibacterial action by
binding to the highly conserved A site of the 16S rRNA
of the bacterial 30S ribosomal subunits, interfering with
protein synthesis with subsequent bacterial death. Fur-
thermore, aminoglycosides have a broad antimicrobial
Open Access AID

Detection of 16S rRNA Methylase Genes in Gram-Negative Bacilli Isolated from Hospitals in Changchun, China
292
Table 2. Susceptibilities of gram-negative bacilli to amika-
cin.
Drug-resistant isolate S strains (%) R strains (%)
Escherichia coli 17 (51.5) 16 (48.5)
Klebsiella pneumoniae 24 (96.0) 1 (4.0)
Enterobacter cloacae 11(78.6) 3 (21.4)
Acinetobacter baumannii 4 (26.7) 11 (73.3)
Pseudomonas aeruginosa 9 (47.4) 10 (52.6)
Serratia marcescens 1 (10.0) 9 (90.0)
Total 66 (56.9) 50 (43.1)
S: Sensitive; R: Resistant.
Table 3. Susceptibilities of gram-negative bacilli to genta-
micin.
Drug-resistant isolate S strains (%) R strains (%)
Escherichia coli 7 (21.2) 26 (78.8)
Klebsiella pneumoniae 14 (56.0) 11 (44.0)
Enterobacter cloacae 6 (42.9) 8 (57.1)
Acinetobacter baumannii 0 (0.0) 15 (100)
Pseudomonas aeruginosa 2 (10.5) 17(89.5)
Serratia marcescens 0 (0.0) 10 (100)
Total 29 (25.0) 87 (75.0)
S: Sensitive; R: Resistant.
Table 4. Detection results of 16S rRNA methylase genes.
Drug-resistant isolates armA (%) rmtB (%)
Escherichia coli 1 (3.0) 18 (54.5)
Klebsiella pneumoniae 0 (0.0) 0 (0.0)
Enterobacter cloacae 1 (7.1) 0 (0.0)
Acinetobacter baumannii 5 (33.3) 0 (0.0)
Pseudomonas aeruginosa 0 (0.0) 14 (73.7)
Serratia marcescens 7 (70.0) 4 (40.0)
Total 14 (12.1) 36 (31.0)
Note: rmtA, rmtC, rmtD, and npmA are negative.
spectrum and produce synergistic effects with other kinds
of antibiotics. Because of massive use of antibiotics in-
cluding aminoglycosides, problems related to bacterial
resistance to aminoglycosides are becoming very serious.
Such resistance is achieved by enzymatic modification,
changes in cellular membrane permeability, efflux pump
activity, the phoP-phoQ system, or 16S rRNA methylase
activity [10-12]. 16S rRNA methylase is usually encoded
M: DNA Marker; Lanes 1-4: armA.
Figure 1. Electrophoregram of PCR amplified products of
16S rRNA methylase gene armA.
M: DNA Marker; Lanes 1-3: rmtB.
Figure 2. Electrophoregram of PCR amplified products of
16S rRNA methylase gene rmtB.
by plasmids, and its transfer via plasmids has led to the
rapid spread of 16S rRNA methylase genes among bacilli
[13,15], causing great difficulties for clinical treatment.
Our study showed that 43.1% and 75% of a sample of
116 gram-negative bacillus isolates were resistant to ami-
kacin and gentamicin, respectively. Except for the low
resistance rates among the K. pneumoniae and E. cloacae
strains, the resistance rates among the other strains of
gram-negative bacilli were all greater than 45%, indicat-
ing high rates of aminoglycoside resistance among gram-
negative bacilli in the Changchun area. In terms of the
16S rRNA methylase genetic testing, the frequency of
rmtB (31.0%) in our sample was higher than that of armA
(12.1%). Furthermore, rmtB is mainly distributed among
E. coli (54.5%) and P. aeruginosa (73.7%) strains; where-
as armA is mainly distributed among A. baumannii (33.3%)
and S. marcescens (70%) strains. We did not detect any
16S rRNA methylase genes among 25 K. pneumoniae
strains; and we only found 1 rmtA gene among 14 strains
of E. cloacae (7.1%). The three S. marcescens strains that
carried both armA and rm tB showed strong resistance to
both amikacin and gentamicin. In our study, the frequen-
cy of aminoglycoside resistance among the 116 strains of
gram-negative bacilli was higher than the frequency of
16S rRNA methylase genes, suggesting that the drug-re-
sistant phenotypes were not totally consistent. Therefore,
some of the aminoglycoside resistance in our sample was
likely caused by other antibiotic resistance mechanisms
such as the production of AME genes, changes in cellu-
lar membrane permeability, efflux pump activity, or the
phoP-phoQ system.
In terms of the distribution of 16S rRNA methylase ge-
Open Access AID

Detection of 16S rRNA Methylase Genes in Gram-Negative Bacilli Isolated from Hospitals in Changchun, China 293
nes, only the armA and rmtB genes were detected in our
study, suggesting that armA and rmtB are the two main
16S rRNA methylase genes in the Changchun area,
which is consistent with relevant domestic studies [16,
17]. The armA and rmtB genes are also the most com-
mon genotypes in other Asian countries such as South Ko-
rea [18] and Japan [19]. The most commonly detected
16S rRNA methylase genes in European countries such
as Belgium [20] and Bulgaria [21] is armA, whereas in
Brazil it is rmtB [22]. According to our data, high-level
aminoglycoside resistance in clinical isolates conferred
by 16S rRNA methylase is of great concern in Chang-
chun area. Hence, clinicians must pay more attention to
the rational use of such drugs to reduce the frequencies
of drug-resistant bacteria under the selective pressure by
antibiotics.
5. Conclusion
In conclusion, our experimental results suggest that the
predominant 16S rRNA methylase genes among gram-
negative bacillus isolates from Changchun area, Northeast
of China, are armA and rmtB. Aminoglycoside-resistant
isolates producing armA or rmtB may become a major
therapeutic threat in the future.
6. Acknowledgements
The study was supported by both National Natural Sci-
ence Foundation of China (Grant number: 81150037) and
High-tech industry development projects of Jilin Pro-
vince (Grant number: 2009633).
REFERENCES
[1] K. Yokoyama, Y. Doi, K. Yamane, H. Kurokawa, N. Shi-
bata, K. Shibayama, T. Yagi, H. Kato and Y. Arakawa,
“Acquisition of 16S rRNA Methylase Gene in Pseudomo-
nas Aeruginosa,” Lancet, Vol. 362, No. 9399, 2003, pp.
1888-1893.
http://dx.doi.org/10.1016/S0140-6736(03)14959-8
[2] B. Bercot, L. Poirel and P. Nordmann, “Plasmid-Media-
ted 16S rRNA Methylases among Extended-Spectrum β-
Lactamase-Producing Enterobateriaceae Isolates,” Anti-
microbial Agents and Chemotherapy, Vol. 52 No. 12,
2008, pp. 4526-4527.
http://dx.doi.org/10.1128/AAC.00882-08
[3] M. Galimand, P. Courvalin and T. Lambert, “Plasmid-
Mediated High Level Resistance to Aminoglycoside in
Enterobacteriaceae Due to 16S rRNA Methylation,” An-
timicrobial Agents and Chemotherapy, Vol. 47, No. 8,
2003, pp. 2565-2571.
http://dx.doi.org/10.1128/AAC.47.8.2565-2571.2003
[4] J. Wachino, K. Yamane, K, Shibayama, H. Kurokawa, N.
Shibata, S. Suzuki, Y. Doi, K. Kimura, Y. Ike and Y.
Arakawa, “Novel Plasmid-Mediated 16S rRNA Methy-
lase, rmtC, Found in a Proteous Mirabilis Isolate Demon-
strating Extraordinary High-Level Resistance against Va-
rious Aminoglycosides,” Antimicrobial Agents and Che-
motherapy, Vol. 50, No. 1, 2006, pp. 178-184.
http://dx.doi.org/10.1128/AAC.50.1.178-184.2006
[5] K. Yamane, J. Wachino, Y. Doi, H. Kurokawa and Y. Ara-
kawa, “Global Spread of Multiple Aminoglycoside Genes,”
Emerging Infectious Disease, Vol. 11, No. 6, 2005, pp.
951-953. http://dx.doi.org/10.3201/eid1106.040924
[6] F. Yu, L. Wang, J. Pan, D. Yao, C. Chen, T. Zhu, Q. Lou,
J. Hu, Y. Wu, X. Zhang, Z. Chen and D. Qu, “Prevalence
of 16S rRNA Methylase Genes in Klebsiella Pneumoniae
Isolates from a Chinese Teaching Hospital: Coexistence
of rmtB and armA Genes in the Same Isolate,” Diagnostic
Microbiology and Infectious Disease, Vol. 64, No. 1,
2009, pp. 57-63.
http://dx.doi.org/10.1016/j.diagmicrobio.2009.01.020
[7] B. Li, X. Zhang, J. Li and Y. Sun, “Genotypes and Distri-
bution of Extended-Spectrum β-Lactamases in Gram-Ne-
gative Bacilli Isolated from Changchun Area,” Journal of
Jilin University (Medicine Edition), Vol. 36, No. 1, 2010,
pp. 205-209.
[8] J. Zhu, D. Xiao, R. Jiang and K. Wu, “Investigation of
Aminoglycoside Modifying Enzyme Genes and 16S rRNA
Methylase Genes in Multidrug Resistant Klebsiella Pneu-
moniae,” Chinese Journal of Nosocomiology, Vol. 22, No.
17, 2012, pp. 3690-3693.
[9] Y. Deng, Z. Zeng, S. Chen, L. He, Y. Liu, C. Wu, Z.
Chen, Q. Yao, J. Hou, T. Yang and J. Liu, “Dissemina-
tion of IncFII Plasmids Carring rmtB and qepA in Esche-
richia coli from Pigs, Farm Workers and the Environ-
ment,” Clinical Microbiology and Infection, Vol. 17, No.
11, 2011, pp. 1740-1745.
http://dx.doi.org/10.1111/j.1469-0691.2011.03472.x
[10] L. Kotra, J. Haddad and S. Mobashery, “Aminoglyeosi-
des: Perspectives on Mechanisms of Action and Resis-
tance and Strategies to Counter Resistance,” Antimicro-
bial Agents and Chemotherapy, Vol. 44, No. 12, 2000, pp.
3249-3256.
http://dx.doi.org/10.1128/AAC.44.12.3249-3256.2000
[11] S. Islam, H. Oh, S. Jalal, F. Karpati, O. Ciofu, N. Høiby
and B Wretlind, “Chromosomal Mechanisms of Amino-
glycoside Resistance in Pseudomonas Aeruginosa Isolates
from Cystic Fibrosis Patients,” Clinical Microbiology and
Infection, Vol. 15, No. 1, 2009, pp. 60-66.
http://dx.doi.org/10.1111/j.1469-0691.2008.02097.x
[12] E. Macfarlan, E. Kwasnicka and R. Hancock, “Role of
Pseudomonas Aeruginosa PhoP-PhoQ in Resistance to
Antimicrobial Cationic Peptides and Aminoglycosides,”
Microbiology, Vol. 146, No. 10, 2000, pp. 2543-2554.
[13] Y. Doi, A. C. Ghilardi, J. Adams, D. de Olivera Garcia
and D. L. Paterson, “High Prevalence of Metallo-β-Lacta-
mase and 16SrRNA Methylase Coproduction among Imi-
penem-Resistant Pseudomonas Aeruginosa Isolates in
Brazil,” Antimicrobial and Agents Chemotherapy, Vol. 51,
No. 9, 2007, pp. 3388-3390.
http://dx.doi.org/10.1128/AAC.00443-07
[14] J. Wachino and Y. Arakawa., “Exogenously Acquired 16S
rRNA Methyltransferases Found in Aminoglycoside-Re-
sistant Pathogenic Gram-Negative Bacteria: An Update,”
Drug Resistance Updates, Vol. 15, No. 3, 2012, pp. 133-
Open Access AID

Detection of 16S rRNA Methylase Genes in Gram-Negative Bacilli Isolated from Hospitals in Changchun, China
Open Access AID
294
148. http://dx.doi.org/10.1016/j.drup.2012.05.001
[15] Y. J. Park, “Aminoglycoside Resistance in Gram-Nega-
tive Bacilli,” Korean Journal of Clinical Microbiology,
Vol. 12, No. 2, 2009, pp. 57-61.
http://dx.doi.org/10.5145/KJCM.2009.12.2.57
[16] J. Cui, S. Zhao, Y. Qin, T. Gao, X. Wang and G. Feng,
“Investigation of Related Genes of Aminoglycoside Re-
sistant on Multi-drug Resistance Pseudomonas Aerugino-
sa,” Chinese Journal of Nosocomiology, Vol. 20, No. 20,
2010, pp. 3099-3012.
[17] Y. Li, Y. Wu, H. Li and Y. Yang, “Investigation of 16S
rRNA Methylase Genes in Gentamicin-Resistant Entero-
bacter Cloacae,” Chinese Journal of Microecology, Vol.
23, No. 7, 2011, pp. 612-614.
[18] M. Gurung, D. C. Moon, M. D. Tamang, J. Kim, Y. C.
Lee, S. Y. Seol, D. T. Cho and J. C. Lee, “Emergence of
16S rRNA Methylase Gene armA and Cocarriage of bla-
IMP-1 in Pseudomonas Aeruginosa Isolates from South
Korea,” Diagnostic Microbiology and Infectious Disease,
Vol. 68, No. 4, 2010, pp. 468-470.
http://dx.doi.org/10.1016/j.diagmicrobio.2010.07.021
[19] Y. Doi, K. Yokoyama, K. Yamane, J. Wachino, N. Shiba-
ta, T. Yagi, K. Shibayama, H. Kato and Y Arakawa,
“Plasmid-Mediated 16S rRNA Methylase in Serratia Mar-
cescens Conferring High-Level Resistance to Aminogly-
cosides,” Antimicrobial Agents and Chemotherapy, Vol.
48, No. 2, 2004, pp. 491-496.
http://dx.doi.org/10.1128/AAC.48.2.491-496.2004
[20] P. Bogaerts, M. Galimand, C. Bauraing, A. Deplano, R.
Vanhoof, R. De Mendonca, H. Rodriquenz-Villalobos, M.
Struelens and Y Glupczynski, “Emergence of ArmA and
RmtB Aminoglycoside Resistance 16S rRNA Methylases
in Belgium,” Journal of Antimicrobial Chemotherapy,
Vol. 59, No. 3, 2007, pp. 459-464.
http://dx.doi.org/10.1093/jac/dkl527
[21] S. Sabtcheva, T. Saga, T. Kantardjiev, M. Ivanova, Y. Ishii
and M. Kaku, “Nosocomial Spread of Arma-Mediated
High-Level Aminoglycoside Resistance in Enterobacteri-
aceae Isolates Producing CTX-M-3 Beta-Lactamase in a
Cancer Hospital in Bulgaria,” Journal of Chemotherapy,
Vol. 20, No. 5, 2008, pp. 593-599.
[22] Y. Doi, G. Oliveira, J. Adams and D. L. Paterson, “Co-
production of Novel 16S rRNA Methylase RmtD and
Metallo-β-Lactamase SPM-1 in a Panresistant Pseudomo-
nas Aeruginosa Isolate from Brazil,” Antimicrobial Agents
and Chemothearapy, Vol. 51, No. 3, 2007, pp. 852-856.
http://dx.doi.org/10.1128/AAC.01345-06